• If you are having problems logging in please use the Contact Us in the lower right hand corner of the forum page for assistance.

Atypical Scrapie and Nor98 Cases, France and Norway similar

flounder

Well-known member
Volume 13, Number 1–January 2007
Research
Similar Biochemical Signatures and Prion Protein Genotypes in Atypical Scrapie and Nor98 Cases, France and Norway
Jean-Noël Arsac,* Olivier Andreoletti,† Jean-Marc Bilheude,‡ Caroline Lacroux,† Sylvie L. Benestad,§ and Thierry Baron*
*Agence Française de Sécurité Sanitaire des Aliments, Lyon, France; †Ecole Nationale Vétérinaire de Toulouse, Toulouse, France; ‡Bio-Rad, Marnes-la-Coquette, France; and §National Veterinary Institute, Oslo, Norway
Suggested citation for this article

Abstract
Isolates of atypical scrapie recently identified in sheep and goats in France were compared with Nor98 isolates reported in Norway. Western blot methods for characterization of the protease-resistant prion protein showed that all these isolates shared a unique biochemical signature: 5 groups of bands, including a characteristic band of apparent low molecular weight (11 kDa). This pattern could originate from the presence of 3 different protease cleavage products, including the 11 kDa most likely cleaved at both N- and C-sides of the protein. Genetic data, which strongly suggested the higher susceptibility of AHQ and AF141RQ animals in French cases, resembled earlier data from Nor98 scrapie.

Transmissible spongiform encephalopathies (TSEs) are neurodegenerative disorders that occur in sheep and goats (scrapie), cattle (bovine spongiform encephalopathy [BSE]), or humans (Creutzfeldt-Jakob disease). The biochemical marker of the disease is currently considered to be the accumulation of an abnormal isoform (PrPres) of the normal cellular prion protein (PrPc). PrPres can be identified by its partial resistance to proteases and insolubility in detergents. Classically, after pK treatment and Western blot (WB), PrPres exhibits a typical 3-band pattern comprising 18–30 kDa, whereas PrPc is totally digested (1,2).

Ovine susceptibility to scrapie is largely controlled by polymorphisms at the PrP gene (prnp). The major polymorphisms associated with susceptibility or resistance are located at codons 136 (A or V), 154 (R or H), and 171 (R, Q, or H) (3,4). V136R154Q171/VRQ, ARQ/VRQ, and ARQ/ARQ PrP animals are considered the most susceptible to scrapie, whereas homozygous or heterozygous AHQ and heterozygous ARR animals show only marginal susceptibility (5). ARR/ARR sheep are considered to be the more resistant (4,6), but after oral challenge with BSE agent they can accumulate PrPres in the spleen (7).

In 1998, a novel and unusual TSE type (called Nor98) was identified in sheep in Norway (8). A large proportion of animals were carriers of AHQ and AF141RQ alleles (9). The PrP WB signature in these cases differed from the known scrapie profile; the classic 3-band WB pattern was replaced by a multiband pattern with a prominent band of low molecular mass (˜12 kDa).

Since 2002, an active surveillance program for TSE has been implemented in small ruminants in European Union (EU) countries. As a result of this program, unusual TSE isolates were rapidly identified in sheep and goats in France, Germany (10,11), and Great Britain (12). These atypical TSE isolates had the following characteristics: 1) they came from sheep carrying PrP alleles reportedly associated with resistance to TSEs; 2) their rapid diagnostic test results based on PrPres detection showed discrepancies; and 3) they could not be readily confirmed by recommended Office International des Epizooties diagnostic methods (10). In this study we investigated a panel of 54 French atypical isolates from sheep (n = 51) and goats (n = 3) and compared their PrP genotypes and advanced PrPres biochemical signatures (WB electrophoretic mobility, epitope mapping, and PrPres deglycosylation pattern) with those of Nor98 cases.

Materials and Methods
Small Ruminant Isolates
The biologic samples (Table) consisted of 54 brain stems from 51 sheep from France and 3 goats previously classified as having atypical scrapie and collected during the active surveillance program between 2002 and 2004. These samples were compared with Nor98 samples from 4 Norwegian sheep.

The prnp polymorphisms from these atypical cases were compared with a panel from animals with classic scrapie (74 clinically affected sheep obtained from 60 flocks between 2000 and 2002 and 60 scrapie-positive goats obtained from 13 flocks between 2002 and 2004. The animals with classic scrapie were not matched for age, breed, or flock structure with animals with atypical scrapie.

prnp ORF Sequencing
In each case, DNA was directly recovered from brain stem (30 mg) by using a commercial DNA extraction kit (Qiaprep DNeasy Minikit (QIAGEN, Courtaboeuf, France) according to manufacturer's recommendations. The complete open reading frame (ORF) sequence of the prnp gene was determined by sequencing both strands of 2 overlapping PCR fragments covering the complete ovine prnp ORF (primer 1F: GTGGGCATTTGATGCTGACAC, primer 1R: TGGTTGGGGTAACGGTACATG, Tm1 59°C, primer 2F: TCAGCCCCATGGTGGTGGCT, primer 2R: CTGCAGGTAGACACTCCCTCC, Tm2 61°C). The same primers were used for the goat samples.

The PCR products were amplified for 35 cycles (extension time 45 s) and allowed to migrate on 1% agarose gel. They were then purified, and both strands were sequenced. The appropriate software (SemanII, DNAstar, Monluçon, France) was then used to reconstitute the ORF sequence and align it with reference sequences from both ovine and caprine species.

PrPres Purification and Western Blotting
Samples were examined by TeSeE WB (Bio-Rad, Marnes la Coquette, France), according to manufacturer's recommendations. Briefly, 20% brain homogenate was incubated with pK and detergent solution for 10 min at 37°C before buffer B was added. Samples were then centrifuged at 15,000× g for 7 min and the pellet solubilized by incubation at 100°C for 5 min in 100 µL Laemmli solution completed (Bio-Rad)with 5% (v/v) ß-mercaptoethanol and 2% (w/v) sodium dodecyl sulfate (SDS). Samples were centrifuged at 15,000× g for 15 min. The supernatants were then heated at 100°C for 5 min and subjected to electrophoresis. The undiluted sample (equivalent to 15 mg of tissue) was loaded onto homemade acrylamide SDS-polyacrylamide gels.

Gels (15% resolving gel and 4% stacking gel) were subjected to electrophoresis for 60 min at 200 V. The proteins were transferred onto a polyvinylidene difluoride membrane at 115 V for 60 min. The membrane was soaked successively with phosphate-buffered saline (PBS), ethanol, and distilled water; saturated with blocking solution for 30 min; and then incubated for 30 min at room temperature with Sha 31 (4 µg/mL in PBS-Tween [PBST]) against the YEDRYYRE (148–155) ovine PrP sequence (13). The membrane was then washed with PBST and incubated for 20 min with goat anti-mouse immunoglobulin G (IgG) antibody conjugated with horseradish peroxidase diluted 1:10 in PBST. It was the subjected to the enhanced chemiluminescence WB detection (Amersham or Supersignal, Pierce, Orsay, France) and visualized by using the Versa Doc image analysis system (Bio-Rad).

MW Determination
A panel of 20 of these samples from 17 French sheep with atypical cases, 2 French goats with atypical cases, and a Norwegian sheep with Nor98 (Table) were selected for detailed molecular characterization. The apparent molecular weights (MWs) were determined with a protein standard (B2787; Sigma, Saint Louis, MO, USA). Each band was measured (apparent MWs and proportions) by using Quantity One software (Bio-Rad).

Epitope Mapping
Different monoclonal antibodies (MAbs) were used for detection of PrPres fragments: Sha 31 (4 µg/mL in PBST), P4 (1/2,500 in PBST) (R-Biopharm, Saint-Didier Au Mont d'Or, France), 4F2 (1/2,500 in PBST), and 99/97.6.1 (1/2,500 in PBST). They recognized the following respective ovine sequences: YEDRYYRE (148–155) (13), WGQGGSH (93–99) (14),QPHGGGW (62–93), and 99/97.6.1 YQRE (221–224) (J. Langeveld, unpub. Pepscan data). The membranes were washed and then incubated with peroxidase-labeled conjugates against mouse Ig (1/2,500 in PBST) (Ozyme, Saint Quentin/Yvelines, France).

Deglycosylation Experiments
Deglycosylation experiments were performed on 6 French and 1 Nor98 isolates with PNGaseF, following the Ozyme manufacturer's instructions (P0704S) and TeSeE WB protocol for sample purification. Briefly, after PrPres purification, the pellet was solubilized by incubating at 100°C for 10 min in glycoprotein denaturing buffer 1× instead of Laemmli (Bio-Rad) solution. Samples were treated with PNGase F for 1 h at 37°C (reaction buffer 1×, 10% NP-40, PNGase F); buffer B was then added. Samples were centrifuged at 15,000× g for 7 min, and the pellets were solubilized in 100 µL completed Laemmli solution by incubation at 100°C for 5 min. Samples were then centrifuged at 15,000× g for 15 min, and the supernatants were heated at 100°C for 5 min before electrophoresis.

Results
All the atypical cases detected in France by the surveillance program were initially identified by an ELISA rapid diagnosis test (TeSeE Bio-Rad). The brain stem samples in our atypical scrapie panel (n = 54) invariably gave negative results with modified SAF (Scrapie-associated fibrils) Immunoblot (10,15). However, the 51 sheep and 3 goat isolates analyzed gave positive results with the highly sensitive WB method (TeSeE Bio-Rad), which used the classic pK concentration for sample digestion and Sha31 MAb for PrPres detection.

PrP Genetics of Classic and Atypical Cases
The prnp genotypes at codons 136, 141, 154, and 171 are shown in the Table. Most (87.8%) samples from sheep with classic scrapie were observed in genotypes with combinations of the ARQ, ARH, and VRQ alleles. A small proportion (12%) of classic scrapie cases were observed in AF141RQ carriers, but no classic scrapie was found in animals carrying the AHQ or ARR allele.

A large proportion (82.3%) of animals in the atypical sheep scrapie group carried the AF141RQ (n = 35, 68.6%) or AHQ (n = 7, 13.7%) allele. An unusually high proportion of atypical cases were ARR heterozygous (n = 20, 39.2%), but in 16 cases the ARR allele was associated with either the AF141RQ or AHQ allele. Six of the atypical cases were ARR/ARR homozygous (11.8%).

Only 3 of the atypical cases had genotypes combining the ARQ, ARH, and VRQ alleles association, which was strikingly different from the group of classic sheep scrapie cases. Similarly, only 4 animals (7.8%) carried the highly susceptible VRQ allele, and in all cases this was associated with the AF141RQ allele. Two of the 3 goats with atypical cases carried the AHQ allele (1 homozygous and 1 heterozygous), whereas none of the 60 sheep with cases of classic scrapie carried the AHQ allele (Table). Taken together, these data strongly suggest that AHQ and AF141RQ animals are more susceptibile to atypical scrapie than to classic scrapie.

PrPres WB Pattern of Atypical Scrapie and Nor98 Isolates
Figure 1

Figure 1. Atypical scrapie and Nor98 isolates PrPres Western blot pattern. Western blot (WB) profile in atypical (A, lane 2) and classic (B, lane 3) scrapie isolates...


Figure 2

Figure 2. Western blot profiles of PrPres in an atypical scrapie isolate (lane 2) detected by using N-terminal (4F2, P4), central (Sha31), or C-terminal (99/97.6.1) monoclonal antibodies...


Figure 3

Figure 3. A) Schematic representation of ovine PrPc with location of epitopes recognized by the monoclonal antibodies used during the study and approaching sizes...

All the atypical isolates showed a complex multiband pattern that differed dramatically from the 3-band pattern observed in classic scrapie (Figure 1A, B). Five major bands (designated I to V according to increasing electromobility) could be distinguished in all atypical cases, irrespective of genotype or species (sheep or goat); in all 54 cases, a V band was clearly observed around 11 kDa.

Twenty isolates, from 17 sheep with various genotypes, 2 goats, and 1 Nor98 sheep (Table), were subjected to repeated electrophoresis to measure the bands' apparent form. According to our measurements, the patterns from the 19 French atypical cases were very similar to each other and indistinguishable from those from the Norwegian Nor98 isolate (Figure 1C).

However, a slight variability could be observed in the apparent MWs between cases. Variations of the WB method were further examined in repeated runs of PrPres isolated from a classic scrapie isolate to assess their possible significance. The analysis of 15 different runs of such a sample showed a variation coefficient (standard deviation divided by mean) of 2.1% (±0.1%) for the 3 bands. The observed variations in the individual measures for atypical scrapie samples were 2.0% (±1.0%) for bands I to IV and 4.5% (±3.0%) for band V. These findings strongly suggest that the observed variations between the different samples were probably due to the method rather than to significant differences between samples.

The proportion of total PrPres WB signal represented by each band in the same panel of 19 French atypical cases was measured (Figure 1D). Band II was significantly more intense (mean 35%) than band III (mean 20%) or bands I, IV, and V (means 10%–15%). Two individual peaks could be identified in bands II and III in runs and lanes with the highest resolution. These 2 peaks were located at 28.5 (±0.6) and 26.6 (±0.55) kDa in band II and at 22.5 (±0.8) and 20.9 (±0.4) kDa in band III (Figure 2, small arrows).

PrPres Deglycosylation and Epitope Mapping
Deglycosylations experiments with PNGase before WB analysis were then conducted to investigate the origin of this complex banding pattern. Because of the limited amount of field-collected material (brain stem only) and their low PrPres levels, only 6 atypical sheep isolates and 1 Nor98 isolate could be investigated. A similar pattern of 3 bands at 23.0 (±0.5), 17.8 (±0.7), and 10.9 (±0.4) kDa (referred to as A, B, and C forms, respectively) (Figure 1E) was observed in all 7 samples. PNGase treatment of classic scrapie cases resulted in a single band at 19.2 (±0.4) kDa (Figure 1F), which is consistent with already published data.

The biochemical pattern was characterized by epitope mapping of PrPres using 4F2 (62–93), P4 (93–99), Sha 31 (148–155), and 99/97.6.1 (221–224) (Figure 2). Bands I to III were strongly recognized by all 4 MAbs in our panel, which indicated that the 3 bands at least contained the 85– to 155–amino acid sequence. Band IV was clearly recognized by P4 and Sha31 antibodies and faintly by 4F2 and 99/97.6.1. Band V was not recognized by the more C-terminal 99/97.6.1 antibody, which suggests that this band corresponds to a C-terminal cleaved PrPres fragment but was labeled by the 3 other MAbs, although more weakly by the 4F2 antibody.

Discussion
In this study, we characterized a series of TSE isolates from French sheep and goats originally classified as having atypical scrapie cases (10) on the basis of discrepancies between rapid diagnostic tests and confirmatory methods used to detect PrPres in brain stem samples. Similar discrepancies had been observed in the early description of so-called Nor98 scrapie isolates (8). The long-debated hypothesis that atypical cases and Nor98 cases could be only artifacts and not true TSE was recently ruled out by the successful transmission of 10 of these French atypical isolates and 3 Nor98 isolates to transgenic mice overexpressing the ovine PrP (V136 R154 Q171 allele) (16). Similarly, PrPres could be detected by using the TeSeE Bio-Rad WB method for all the French atypical and Nor98 cases studied here.

Original PrPres WB Signature
We found that PrPres showed a unique biochemical signature in all cases (54 French atypical and 4 Nor98 isolates) in comparison to classic scrapie, with 1) a multiband pattern with a characteristic band of low MW (11 kDa) and 2) 3 distinct deglycosylated PrPres forms of 23, 18, and 11 kDa (A, B, and C fragments, respectively). Given the theoretical MW of ˜22.8 kDa of the mature ovine PrP protein, the results obtained with all 4 antibodies in our panel, and the C-terminal 99/97.6.1 epitope undetected from only band V, the following hypothetical sequences of the A, B, and C fragments can be inferred (Figure 3A; [17]). The PrPres fragment A (23 kDa) might correspond to a native (uncleaved or marginally cleaved by pK treatment) PrP fragment. The PrPres fragment B could be N terminally cleaved (nearby 4F2 epitope), as in classic scrapie, although cleavage of the C-terminal end cannot be fully excluded. While this scenario is already suggested by the faint labeling with 99/97.6.1 antibody, it would also be consistent with the observation that, despite the presence of the P4 epitope, PrPres B apparently has a lower mass than PrPres in ovine BSE (18). The C fragment (11 kDa) could correspond to an N (nearby 4F2 epitope) and C terminally cleaved PrPres protein.

If one assumes that the PrPres glycosylation process could be similar in classic (+3.8 or +7.9 for monoglycosylation and biglycosylation, respectively) and atypical scrapie cases, the theoretical MWs of the unglycosylated, monoglycosylated, and biglycosylated forms that could be derived from A, B, and C fragments can be reconstituted and compared with the banding pattern observed with different antibodies, such as Sha31 MAb (Figure 3B). Glycosylations of the 23-kDa A form would result in bands at 26.8 kDa and 30.9 kDa and those of the 18-kDa B form in bands at 21.6 and 25.7 kDa. These forms are consistent with bands I to IV, as well as with the presence of 2 distinct PrP forms detectable in both band II and band III in WB with the highest resolution (Figure 3B). The absence of detectable bands at 15 kDa and 19 kDa with any of the antibodies tested could suggest that the C form would only be present in the unglycosylated form. This lack of glycosylation would be consistent with a C-terminal cleavage of this PrP form upstream from the N-glycosylation sites (amino acids 184 and 200). Taken together, these hypotheses could explain the unique WB pattern identified in all the French atypical and Nor98 isolates studied here (Figure 3B). However, other hypotheses, such as the existence of random pK-digested fragments resulting in 3 major PrPres with variable sequences after deglycosylation, cannot be fully excluded.

These hypotheses need to be considered in the light of results recently published by Klingeborn et al. (19). After purification of PrPres,including a pK treatment at 100 µg/mL for 1 h at 37°C, and concentration by precipitation with trichloroacetic acid, these authors detected 2 PrPres products at 7 kDa (Nor98-PrP7) and 14 kDa (PrP-CTF14) in Nor98 case isolates from Swedish sheep. Importantly, 1 of these Swedish Nor98 cases was investigated in a laboratory taking part in this study (that of S.L. Benestad) and showed the same pattern with the band of low MW at 11 kDa with TeSeE Bio-Rad WB. Differences in the apparent molecular masses between the isolates from the 2 studies could result, at least in part, from the different methods used for PrPres purification and concentration, when one considers the high pK sensitivity of PrPres in atypical scrapie (10,12). The choice of antibodies could also contribute to the observed differences. For instance, in our study, band V consistently showed an apparently lower molecular mass (9–10 kDa), with P4 antibody (antibody used in the Klingeborn et al. study). Therefore, fragments C (11 kDa) and B (18 kDa) could correspond to Nor98-PrP7 and PrP-CTF14, respectively, in the harsher pK conditions used by Klingeborn et al. PrPres fragment A (23 kDa) was not observed by Klingeborn et al., which suggests that this PrPres form might be completely digested or transformed into fragments of Nor98-PrP7, PrP-CTF14, or both. Despite minor differences, the results of the 2 studies in regard to the particular molecular features of atypical scrapie/Nor98 isolates are consistent.

The presence of a PrPres fragment with an apparently low molecular mass, which is a salient feature of atypical and Nor98 cases, has already been reported in several human diseases. N terminally truncated PrPres migrating to either 12 kDa or 13 kDa have been reported in some sporadic Creutzfeldt-Jakob disease cases (20). The identification of a low-MW fragment cleaved at both C- and N-terminal ends of the prion protein has even been described as the hallmark of Gerstmann-Sträussler-Scheinker syndrome in humans (2,21–24). However, even if these atypical isolates appear to have similarities with those from rare human prion diseases, atypical cases of scrapie are not rare in sheep and goats and, in some countries, are more frequent than the classic disease.

Biodiversity in Atypical Cases
The isolates from the 54 atypical cases we investigated here, which included a large panel of different PrP genotypes and 2 species (sheep and goat), possessed a unique biochemical signature, indistinguishable from that of the Nor98 isolates. All of the isolates from the French atypical and Nor98 cases that were transmitted to Tg338 ovine transgenic mice also shared the same biologic signature, with comparable incubation periods, clinical signs, lesion profiles, and PrPres deposits patterns in the central nervous system (16). Moreover, the PrPres biochemical signature in the inoculated Tg338 was strikingly comparable to that observed in the present study. Taken together, these data strongly suggest that the prions involved in atypical (sheep and goat) and Nor98 cases are in fact a unique TSE agent. However, because our cases were obtained from only 2 countries, whereas atypical cases have been identified throughout Europe (12,25–29), further studies are required before definitive conclusions can be drawn. Nevertheless, the lack of diversity in our panel, combined with the identity with Nor98 cases, suggests that the biodiversity of the TSE agents of atypical scrapie is not large.

Allelic Tropism in Atypical Cases
Although polymorphisms associated with classic scrapie have been widely documented (4,6), both the atypical and Nor98 cases (9) seemed to deviate from the established concepts of classic scrapie. In our panel, an obviously high susceptibility seemed to be associated with the AHQ and AF141RQ alleles, whereas the VRQ allele was poorly represented. Similar observations were reported for Nor98 cases (8,9).

However, a proper analysis of the risk associated with each genotype in atypical cases will require much more data than those presented here. Indeed, all our atypical case data were collected through active surveillance network, by using a particular rapid diagnosis test. These affected animals would need to be matched for breed, age, and population (detection within the same active surveillance program with similar tests) to permit an appropriate risk factor analysis and comparison of susceptibility with animals with classic scrapie. Moreover, the distribution of F141 within each breed is currently unknown. This work is ongoing in France, and results should be presented soon.

The involvement of ARR/ARR genotype animals not only in our study (6 cases) but also in several EU countries (11,30) is also of some concern. Based on the observed resistance to TSE in homozygous ARR animals, a breeding program for resistance to scrapie and BSE has been implemented in several EU countries to control human exposure to TSE risk. This unusual susceptibility of small ruminants believed to be genetically resistant to TSE could lead to a reevaluation of such a policy. In this context, determining the distribution of infectivity in different tissues of affected animals and whether or not atypical scrapie is naturally transmissible between animals within affected flocks would also be helpful.

Conclusion
Our data provide new information about the recently described atypical cases of TSE. These cases appear to be associated with a novel PrPres biochemical pattern; they shared similarities with some rare prion diseases in humans and were clearly distinct from classic scrapie or BSE. This potential similarity in PrPres formation mechanisms with some other rare prion diseases in humans is intriguing. However, the unusual properties of these atypical cases illustrate our decades of underestimating the biodiversity of TSEs in small ruminants and the consequences. This finding should lead to a general reexamination of our conceptual approach in the control of TSEs in small ruminants.

Acknowledgments
We gratefully acknowledge technical assistance from Joël Delphin, Jonathan Blachier, Dominique Canal, and Jeremy Verchère. MAbs were kindly provided by J. Grassi and K. O'Rourke.

This work was partly supported by the NEUROPRION European network of excellence (EUROSTRAINS project).

Mr Arsac is a doctoral student researching the diagnosis and characterization of prion diseases in ruminants. His research interests include molecular characterization of prion diseases from small ruminants in their natural host and in experimental mouse models.

References
McKinley MP, Bolton DC, Prusiner SB. A protease-resistant protein is a structural component of the scrapie prion. Cell. 1983;35:57–62.
Tagliavini F, Lievens PM, Tranchant C, Warter JM, Mohr M, Giaccone G, et al. A 7-kDa prion protein (PrP) fragment, an integral component of the PrP region required for infectivity, is the major amyloid protein in Gerstmann-Straussler-Scheinker disease A117V. J Biol Chem. 2001;276:6009–15.
Clouscard C, Beaudry P, Elsen JM, Milan D, Dussaucy M, Bounneau C, et al. Different allelic effects of the codons 136 and 171 of the prion protein gene in sheep with natural scrapie. J Gen Virol. 1995;76:2097–101.
Hunter N, Foster JD, Goldmann W, Stear MJ, Hope J, Bostock C. Natural scrapie in a closed flock of Cheviot sheep occurs only in specific PrP genotypes. Arch Virol. 1996;141:809–24.
Baylis M, Chihota C, Stevenson E, Goldmann W, Smith A, Sivam K, et al. Risk of scrapie in British sheep of different prion protein genotype. J Gen Virol. 2004;85:2735–40.
Hunter N, Goldmann W, Foster JD, Cairns D, Smith G. Natural scrapie and PrP genotype: case-control studies in British sheep. Vet Rec. 1997;141:137–40.
Andreoletti O, Morel N, Lacroux C, Rouillon V, Barc C, Tabouret G, et al. Bovine spongiform encephalopathy agent in spleen from an ARR/ARR orally exposed sheep. J Gen Virol. 2006;87:1043–6.
Benestad SL, Sarradin P, Thu B, Schonheit J, Tranulis MA, Bratberg B. Cases of scrapie with unusual features in Norway and designation of a new type, Nor98. Vet Rec. 2003;153:202–8.
Moum T, Olsaker I, Hopp P, Moldal T, Valheim M, Benestad SL. Polymorphisms at codons 141 and 154 in the ovine prion protein gene are associated with scrapie Nor98 cases. J Gen Virol. 2005;86:231–5.
Buschmann A, Biacabe AG, Ziegler U, Bencsik A, Madec JY, Erhardt G, et al. Atypical scrapie cases in Germany and France are identified by discrepant reaction patterns in BSE rapid tests. J Virol Methods. 2004;117:27–36.
Buschmann A, Luhken G, Schultz J, Erhardt G, Groschup MH. Neuronal accumulation of abnormal prion protein in sheep carrying a scrapie-resistant genotype (PrPARR/ARR). J Gen Virol. 2004;85:2727–33.
Everest SJ, Thorne L, Barnicle DA, Edwards JC, Elliott H, Jackman R, et al. Atypical prion protein in sheep brain collected during the British scrapie-surveillance programme. J Gen Virol. 2006;87:471–7.
Feraudet C, Morel N, Simon S, Volland H, Frobert Y, Creminon C, et al. Screening of 145 anti-PrP monoclonal antibodies for their capacity to inhibit PrPSc replication in infected cells. J Biol Chem. 2005;280:11247–58.
Thuring CM, van Keulen LJ, Langeveld JP, Vromans ME, van Zijderveld FG, Sweeney T. Immunohistochemical distinction between preclinical bovine spongiform encephalopathy and scrapie infection in sheep. J Comp Pathol. 2005;132:59–69.
Madec JY, Belli P, Calavas D, Baron T. Efficiency of Western blotting for the specific immunodetection of proteinase K–resistant prion protein in BSE diagnosis in France. Vet Rec. 2000;146:74–6.
Le Dur A, Beringue V, Andreoletti O, Reine F, Lai TL, Baron T, et al. A newly identified type of scrapie agent can naturally infect sheep with resistant PrP genotypes. Proc Natl Acad Sci U S A. 2005;102:16031–6.
Sambrook J, Russell DW. Codons and amino acids. Molecular cloning-laboratory manuals. 3rd edition. Cold Spring Harbor (NY): Cold Spring Harbor Press; 2001. p. A7–9.
Stack MJ, Chaplin MJ, Clark J. Differentiation of prion protein glycoforms from naturally occurring sheep scrapie, sheep-passaged scrapie strains (CH1641 and SSBP1), bovine spongiform encephalopathy (BSE) cases and Romney and Cheviot breed sheep experimentally inoculated with BSE using two monoclonal antibodies. Acta Neuropathol (Berl). 2002;104:279–86.
Klingeborn M, Wik L, Simonsson M, Renstrom LH, Ottinger T, Linne T. Characterization of proteinase K-resistant N- and C-terminally truncated PrP in Nor98 atypical scrapie. J Gen Virol. 2006;87:1751–60.
Zou WQ, Capellari S, Parchi P, Sy MS, Gambetti P, Chen SG. Identification of novel proteinase K-resistant C-terminal fragments of PrP in Creutzfeldt-Jakob disease. J Biol Chem. 2003;278:40429–36.
Tagliavini F, Prelli F, Ghiso J, Bugiani O, Serban D, Prusiner SB, et al. Amyloid protein of Gerstmann-Straussler-Scheinker disease (Indiana kindred) is an 11 kd fragment of prion protein with an N-terminal glycine at codon 58. EMBO J. 1991;10:513–9.
Parchi P, Chen SG, Brown P, Zou W, Capellari S, Budka H, et al. Different patterns of truncated prion protein fragments correlate with distinct phenotypes in P102L Gerstmann-Straussler-Scheinker disease. Proc Natl Acad Sci U S A. 1998;95:8322–7.
Ghetti B, Piccardo P, Spillantini MG, Ichimiya Y, Porro M, Perini F, et al. Vascular variant of prion protein cerebral amyloidosis with tau-positive neurofibrillary tangles: the phenotype of the stop codon 145 mutation in PRNP. Proc Natl Acad Sci U S A. 1996;93:744–8.
Ghetti B, Piccardo P, Frangione B, Bugiani O, Giaccone G, Young K, et al. Prion protein amyloidosis. Brain Pathol. 1996;6:127–45.
Orge L, Galo A, Machado C, Lima C, Ochoa C, Silva J, et al. Identification of putative atypical scrapie in sheep in Portugal. J Gen Virol. 2004;85:3487–91.
Gavier-Widen D, Noremark M, Benestad S, Simmons M, Renstrom L, Bratberg B, et al. Recognition of the Nor98 variant of scrapie in the Swedish sheep population. J Vet Diagn Invest. 2004;16:562–7.
Epstein V, Pointing S, Halfacre S. Atypical scrapie in the Falkland Islands. Vet Rec. 2005;157:667–8.
De Bosschere H, Roels S, Benestad SL, Vanopdenbosch E. Scrapie case similar to Nor98 diagnosed in Belgium via active surveillance. Vet Rec. 2004;155:707–8.
Onnasch H, Gunn HM, Bradshaw BJ, Benestad SL, Bassett HF. Two Irish cases of scrapie resembling Nor98. Vet Rec. 2004;155:636–7.
De Bosschere H, Roels S, Dechamps P, Vanopdenbosch E. TSE detected in a Belgian ARR-homozygous sheep via active surveillance. Vet J. 2005; [Epub ahead of print].
Figures
Figure 1. Atypical scrapie and Nor98 isolates PrPres Western blot pattern. Western blot (WB) profile in atypical (A, lane 2) and classic (B, lane 3) scrapie isolates...
Figure 2. Western blot profiles of PrPres in an atypical scrapie isolate (lane 2) detected by using N-terminal (4F2, P4), central (Sha31), or C-terminal (99/97.6.1) monoclonal antibodies...
Figure 3. A) Schematic representation of ovine PrPc with location of epitopes recognized by the monoclonal antibodies used during the study and approaching sizes...

Table
Table. Atypical, Nor98, and classic scrapie isolates from sheep and goats and distribution of genotypes

Suggested Citation for this Article
Arsac J-N, Andreoletti O, Bilheude J-M, Lacroux C, Benestad SL, Baron T. Similar biochemical signatures and prion protein genotypes in atypical scrapie and Nor98 cases, France and Norway. Emerg Infect Dis [serial on the Internet]. 2007 Jan [date cited]. Available from http://www.cdc.gov/ncidod/EID/13/1/58.htm


http://www.cdc.gov/ncidod/EID/13/1/58.htm




TSS
 

PORKER

Well-known member
Family of CJD Victim Infected by Contaminated Blood Slam Health Chiefs
By James Tozer
Daily Mail, Dec 8, 2006
Straight to the Source
The family of a man killed by the human form of mad cow disease after
being given infected blood yesterday slammed health chiefs who knew
he was at risk but failed to tell him until he was dying.

When Mark Buckland started to become tired and weak, he was wrongly
diagnosed with chronic fatigue syndrome because senior NHS officials
decided to keep his exposure to variant CJD a secret.

It was only three years later when the 32-year-old became too ill to
look after himself and began losing his memory that they finally told
his family he had the incurable brain disease.

Now, as a result of his death, scientists have discovered that
thousands more people could be exposed to vCJD through contaminated
blood.

But his family are furious that he and 65 other patients who also
received blood donated by people who later developed the terrifying
degenerative condition were kept in the dark.

Yesterday his sister Gina, 35, said: "Mark spent the last three years
of his life fighting to find a cure for a disease that he didn't
actually have, and there were people who knew he didn't have it.

"We were told things like he might have committed suicide if he had
known the truth, but he had a right to know he was going to die - he
would have had the chance to do things like travel the world instead.

"They said they didn't want to make people panic, but instead they
staged a cover-up, and that's even worse - it's devastated the whole
family."

Their 58-year-old mother Eve added: "This research just shows they
should have been more open all along - it's disgraceful."

Mr Buckland, a high-flying BT research engineer in Ipswich, had to be
given 40 pints of blood when surgery for an intestinal complaint went
wrong in 1997.

Unbeknown to anyone, just one pint was contaminated with variant
Creutzfeldt-Jakob disease, the deadly degenerative brain disease
spread by eating BSE-infected meat.

The donor who had given the blood died of vCJD in 2000, but at that
point it was not known what the risk was of the recipient developing
the disease.

As there was no test and no cure, a high-level Department of Health
committee took the decision not to inform Mr Buckland or the other
people who had received contaminated blood.

But because his own GP was not told either, when Mr Buckland -
ironically a vegetarian since his teens - began showing symptoms in
2003, he was misdiagnosed with ME.

The following year he was told about his exposure, but according to
his family he was told it was a "one in 1,000" risk and not anything
to worry about.

By this time, Mr Buckland had had to give up work and was dedicating
himself to a website supporting work towards a cure for ME.

But by January this year he was so ill he had to move in with his
parents in Brighton.

As he began to lose his memory, officials finally contacted them to
break the news that he had vCJD. He died in a hospice four months later.

At an inquest into his death, the coroner said Mr Buckland deserved
to have been told the truth sooner.

Of the other 65 transfusion patients exposed to contaminated blood,
two others are known to have developed vCJD.

Many have died from unrelated causes, leaving 24 who have now been
given the facts but face an uncertain future as it is thought some
carriers may never develop symptoms.

Yesterday, writing in The Lancet, Professor John Collinge, who
investigated Mr Buckland's death, concluded that contaminated blood
was an "efficient" route by which vCJD can be spread. He believes
14,000 people could be carrying vCJD without knowing it, and his
research means they could infect many thousands more through
contaminated surgical instruments.

Infection through blood donation is also likely to continue to happen
despite precautions being introduced as there is no failsafe test for
the disease.

Mr Buckland's 62-year-old father Peter said: "I still think if they
had told him there's a chance he could have taken part in drug trials
which just could have made a difference. I still feel he could be
here now.

"But because of their decision he spent a lot of fruitless years
setting up a website and researching an illness he didn't have. It
was a complete and utter waste of time."

A spokeswoman for the Department of Health said when Mark fell ill it
was not known whether vCJD could be transferred through blood.

"We are finding out more information all the time about vCJD which we
are then able to pass on to patients who may be at risk," she added.
 

flounder

Well-known member
----- Original Message -----
From: Terry S. Singeltary Sr.
To: [email protected]
Cc: [email protected] ; [email protected] ; Julie Rawlings ; Michael Coulthart ; [email protected] ; Dave Cavenaugh
Sent: Monday, December 11, 2006 2:39 PM
Subject: TSE advisory committee for the meeting December 14-15, 2006 [TSS SUBMISSION PART 6 RECENT LANCET PAPER FULL TEXT PDF]


Singeltary Submission Part 6. ...

Greetings again Dr. Freas et al at FDA, CBER, Honorable Phyllis Fong of OIG, and others,

I apologize for stringing this submission out in parts, but it's just the way the data is coming.
I thought this most important, that all involved should have this study in full for the upcoming meetings on
December 14 and 15, 2006

TSE advisory committee for the meeting December 14 and 15, 2006 [TSS SUBMISSION PART V LANCET PAPER FULL TEXT PDF]

please use as you wish. ...tss



FOR EASY ACCESS TO LATEST RESEARCH AND SURVEILLANCE, or the lack there of ;


Subject: TRANSMISSIBLE SPONGIFORM ENCEPHALOPATHY TSE



vCJD blood risk HIGH

http://vcjdblood.blogspot.com


vCJD USA 3rd case documented

http://vcjd.blogspot.com/


Creutzfeldt Jakob Disease

http://creutzfeldt-jakob-disease.blogspot.com/


BSE Atypical USA

http://bse-atypical.blogspot.com/


MAD COW DISEASE USA SPONTANEOUS OR FEED ?

http://madcowspontaneousnot.blogspot.com/


SCRAPIE USA

http://scrapie-usa.blogspot.com/


Chronic Wasting Disease

http://chronic-wasting-disease.blogspot.com/


Transmissible Mink Encephalopathy TME

http://transmissible-mink-encephalopathy.blogspot.com


CJD WATCH

http://disc.server.com/Indices/236650.html

http://www.fortunecity.com/healthclub/cpr/349/part1cjd.htm


CJD VOICE

http://disc.server.com/Indices/7498.html


http://members.aol.com/larmstr853/cjdvoice/cjdvoice.htm


Barbara Poulter Singeltary DOD December 14, 1997 'CONFIRMED' Heidenhain Variant of Creutzfeldt Jakob Disease


JOURNAL OF NEUROLOGY

MARCH 26, 2003



RE-Monitoring the occurrence of emerging forms of Creutzfeldt-Jakob

disease in the United States


Email Terry S. Singeltary:


[email protected]



I lost my mother to hvCJD (Heidenhain Variant CJD). I would like to

comment on the CDC's attempts to monitor the occurrence of emerging

forms of CJD. Asante, Collinge et al [1] have reported that BSE

transmission to the 129-methionine genotype can lead to an alternate

phenotype that is indistinguishable from type 2 PrPSc, the commonest

sporadic CJD. However, CJD and all human TSEs are not reportable

nationally. CJD and all human TSEs must be made reportable in every

state and internationally. I hope that the CDC does not continue to

expect us to still believe that the 85%+ of all CJD cases which are

sporadic are all spontaneous, without route/source. We have many TSEs in

the USA in both animal and man. CWD in deer/elk is spreading rapidly and

CWD does transmit to mink, ferret, cattle, and squirrel monkey by

intracerebral inoculation. With the known incubation periods in other

TSEs, oral transmission studies of CWD may take much longer. Every

victim/family of CJD/TSEs should be asked about route and source of this

agent. To prolong this will only spread the agent and needlessly expose

others. In light of the findings of Asante and Collinge et al, there

should be drastic measures to safeguard the medical and surgical arena

from sporadic CJDs and all human TSEs. I only ponder how many sporadic

CJDs in the USA are type 2 PrPSc?


http://www.neurology.org/cgi/eletters/60/2/176#535




Diagnosis and Reporting of Creutzfeldt-Jakob Disease

Singeltary, Sr et al. JAMA.2001; 285: 733-734.

http://jama.ama-assn.org/cgi/content/full/285/6/733?maxtoshow=&HITS=10&hits=10&RESULTFORMAT=&fulltext=dignosing+and+reporting+creutzfeldt+jakob+disease&searchid=1048865596978_1528&stored_search=&FIRSTINDEX=0&journalcode=jama




BRITISH MEDICAL JOURNAL


BMJ


http://www.bmj.com/cgi/eletters/319/7220/1312/b#EL2


BMJ


http://www.bmj.com/cgi/eletters/320/7226/8/b#EL1




Terry S. Singeltary Sr.
P.O. Box 42
Bacliff, Texas USA 77518






----- Original Message -----
From: Terry S. Singeltary Sr.
To: [email protected]
Cc: [email protected] ; [email protected]
Sent: Wednesday, November 29, 2006 1:24 PM
Subject: TSE advisory committee for the meeting December 15, 2006 [TSS SUBMISSION]


November 29, 2006


Greetings FDA, DHH, Dr. Freas, and Dr. Harvey et al,



a kind and warm Holiday Greetings to you all.


i kindly wish to submit the following to the TSE advisory committee for the meeting December 15, 2006,
about the assessment for potential exposure to vCJD in human plasma-derived antihemophilic factor (FVIII) products
manufactured from U.S. plasma donors and related communication material ;


http://a257.g.akamaitech.net/7/257/2422/01jan20061800/edocket.access.gpo.gov/2006/E6-20251.htm



i see the media picked up on this as a 'low risk', from what the gov. agency
perceived to be to them;


http://www.newsday.com/news/health/ats-ap_health14nov27,0,7955259.story?coll=ny-leadhealthnews-headlines



however, i seem to disagree. from my primitive ciphering, i see it another
way. this is a huge catastrophic risk. 3 in 160 is 1.9%. so call that 2%
which is 1 in 50 or twenty per thousand or 20,000 per million. also, what
about the mixed genotypes/mixed susceptibility? what about the silent
carriers that donated tainted blood? what about the sporadic CJDs of UNKNOWN
strain or phenotype? this risk assessment is just more BSe to me. just
another in a long line of industry fed crap. i pray that my assessment is
the one that is wrong. but it is THEY who roll the dice with your life. it
is THEY who refuse to regulate an industry that has run amok. just from a
recall aspect of potentially tainted blood, and these are just recent recalls ;



PRODUCT
Source Plasma, Recall # B-0054-7
CODE
Units: 03MMNC5465, 03MMNC6361, 03MMNC6801, 03MMNC7510, 03MMNC7891,
03MMNC8252, 03MMNC8801, 03MMNC9144, 03MMND1122, 03MMND1478, 03MMND1969,
03MMND2350, 03MMND2825, 03MMND3211, 03MMND3708, 03MMND4072, 03MMND4588,
03MMND4831, 03MMND5320, 03MMND5719, 03MMND6268, 03MMND6683, 03MMND7228,
03MMND7656, 03MMND8211, 03MMND8652, 03MMND9195, 03MMND9618, 03MMNE0628,
03MMNE0884, 03MMNE1597, 03MMNE1979, 03MMNE2644, 03MMNE3064, 03MMNE3707,
03MMNE4122, 03MMNE4750, 03MMNE5080, 03MMNE5876, 03MMNE6218, 03MMNE7189,
03MMNE7587, 03MMNE8027, 03MMNE8645, 03MMNE9029, 03MMNE9641, 03MMNE9979,
03MMNF0491, 03MMNF0685, 03MMNF0937, 03MMNF1260, 04MMNA0351, 04MMNA0707,
04MMNA1241, 04MMNA1650, 04MMNA2291, 04MMNA2646, 04MMNA3340, 04MMNA3719,
04MMNA4312, 04MMNA4683, 04MMNA5298, 04MMNA5750, 04MMNA6407, 04MMNA6816,
04MMNA7482, 04MMNA7915, 04MMNA8632, 04MMNA9076, 04MMNA9723, 04MMNB0063,
04MMNB0696, 04MMNB1100, 04MMNB1845, 04MMNB2285, 04MMNB3035, 04MMNB3485,
04MMNB4213, 04MMNB4672, 04MMNB5841, 04MMNB6652, 04MMNB7162, 04MMNB7930,
04MMNB8453, 04MMNB9239, 04MMNB9747, 04MMNC0456, 04MMNC0931, 04MMNC1578
RECALLING FIRM/MANUFACTURER
BioLife Plasma Services, L.P., Mankato, MN, by facsimile on June 4, 2004.
Firm initiated recall is complete.
REASON
Blood products, collected from a donor who was at increased risk for new
variant Creutzfeldt-Jakob Disease (nvCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
89 units
DISTRIBUTION
CA and Austria


END OF ENFORCEMENT REPORT FOR October 25, 2006

###


http://www.fda.gov/bbs/topics/enforce/2006/ENF00975.html



USA FDA MAD COW BLOOD HUMANS RECALL (these are dime a dozen)


RECALLS AND FIELD CORRECTIONS: BIOLOGICS -- CLASS II
______________________________
PRODUCT
Source Plasma, Recall # B-1708-6
CODE
Units: MI180733, MI180927, MI181625, MI181780, MI182337, MI182519, MI183140,
MI183311, MI183955, MI185006, MI185278, MI185822, MI186081, MI186855,
MI187183, MI187903, MI188273, MI188695, MI189257, MI189553, MI190136,
MI190473, MI191073, MI191395, MI191972, MI192303, MI193473, MI194343,
04MINA0377, 04MINA0801, 05MINA7147, 05MINA7451, 05MINA8094, 05MINA8504,
05MINA9548, 05MINA9883, 05MINB0489, 05MINB0875, 05MINB1469, 05MINB1874,
05MINB3116, 05MINB7192, 05MINB7529, 05MINB8246, 05MINB8612, 05MINB9236,
05MINB9366, 05MINB9475, 05MINB9641, 05MINC0031, 05MINC0237, 05MINC0336,
05MINC0894, 05MINC0964, 05MINC1138, 05MINC1619, 05MINC1750, 05MINC1907,
05MINC1977, 05MINC2375, 05MINC2774, 05MINC3113, 05MINC3484, 05MINC4277,
05MINC4623, 05MINC5623, 05MINC5914, 05MINC7545, 05MINC7870, 05MINC8355,
05MINC8689, 05MINC9437, 05MINC9775, 05MIND0067, 05MIND0393, 05MIND0892,
05MIND0951, 05MIND1836, 05MIND2183 and 05MIND2962
RECALLING FIRM/MANUFACTURER
BioLife Plasma Services L.P., Muncie, IN, by facsimile on November 22, 2005.
Firm initiated recall is complete.
REASON
Blood products, collected from unsuitable donors based on risk factors for
Creutzfeldt-Jakob Disease (CJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
80 units
DISTRIBUTION
CA, NC, and MD

______________________________

PRODUCT
a) Red Blood Cells, Leukocytes Reduced, Recall # B-1714-6;
b) Fresh Frozen Plasma, Recall # B-1715-6;
c) Platelets, Recall # B-1716-6
CODE
a), b), and c) Unit: 2443732
RECALLING FIRM/MANUFACTURER
South Texas Blood and Tissue Center, San Antonio, TX, by letters dated
November 11, 2003 and December 18, 2003. Firm initiated recall is complete.
REASON
Blood products, collected from a donor who was at increased risk for new
variant Creutzfeldt-Jakob Disease (nvCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
3 units
DISTRIBUTION
TX and WI

END OF ENFORCEMENT REPORT FOR SEPTEMBER 13, 2006

###

http://www.fda.gov/bbs/topics/enforce/2006/ENF00969.html


PRODUCT
Fresh Frozen Plasma, Recall # B-1751-6
CODE
Unit: 4936623
RECALLING FIRM/MANUFACTURER
Gulf Coast Regional Blood Center, Houston, TX, by facsimile dated September
16, 2005. Firm initiated recall is complete.
REASON
Blood product, which was collected from an unsuitable donor based on risk
factors for variant Creutzfeldt-Jakob Disease (vCJD), was distributed.
VOLUME OF PRODUCT IN COMMERCE
1 unit
DISTRIBUTION
TX

END OF ENFORCEMENT REPORT FOR SEPTEMBER 6, 2006

###

http://www.fda.gov/bbs/topics/enforce/2006/ENF00968.html



Mon Aug 7, 2006 10:24
71.248.132.189

PRODUCT
a) Red Blood Cells, Recall # B-1587-6;
b) Cryoprecipitated AHF, Recall # B-1588-6;
c) Recovered Plasma, Recal # B-1589-6
CODE
a), b) and c) Unit: 2016719
RECALLING FIRM/MANUFACTURER
Walter Shepeard Community Blood Center, Inc., Augusta, GA, by facsimile on
March 13, 2003. Firm initiated recall is complete.
REASON
Blood products, which were collected from a donor who may be at increased
risk for variant Creutzfeldt-Jakob Disease (vCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
3 units
DISTRIBUTION
GA and Germany

______________________________
PRODUCT
a) Red Blood Cells Leukocytes Reduced, Recall # B-1590-6;
b) Fresh Frozen Plasma, Recall # B-1591-6
CODE
a) and b) Unit: 2443595
RECALLING FIRM/MANUFACTURER
South Texas Blood and Tissue Center, San Antonio, TX, by facsimile on June
30, 2004. Firm initiated recall is complete.
REASON
Blood products, which were collected from a donor who may be at increased
risk for variant Creutzfeldt-Jakob Disease (vCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
2 units
DISTRIBUTION
TX

______________________________
PRODUCT
a) Red Blood Cells Leukocytes Reduced, Recall # B-1592-6;
b) Fresh Frozen Plasma, Recall # B-1593-6
CODE
a) and b) Unit: 2545596
RECALLING FIRM/MANUFACTURER
South Texas Blood and Tissue Center, San Antonio, TX, by facsimile on
December 14, 2004 and January 3, 2005. Firm initiated recall is complete.
REASON
Blood products, which were collected from a donor who may be at increased
risk for variant Creutzfeldt-Jakob Disease (vCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
2 units
DISTRIBUTION
TX

______________________________

http://www.fda.gov/bbs/topics/enforce/2006/ENF00963.html



PRODUCT
a) Red Blood Cells Leukocytes Reduced, Recall # B-1550-6;
b) Fresh Frozen Plasma, Recall # B-1551-6
CODE
a) and b) Unit 2395371
RECALLING FIRM/MANUFACTURER
South Texas Blood and Tissue Center, San Antonio, TX, by fax on August 20,
2003. Firm initiated recall is complete.
REASON
Blood products, which were collected from a donor who may be at increased
risk for variant Creutzfeldt-Jakob Disease (vCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
2 units
DISTRIBUTION
TX
______________________________
PRODUCT
a) Red Blood Cells Leukocytes Reduced, Recall # B-1552-6;
b) Platelets, Recall # B-1553-6;
c) Fresh Frozen Plasma, Recall # B-1554-6
CODE
a), b) and c) Unit 2438702
RECALLING FIRM/MANUFACTURER
South Texas Blood and Tissue Center, San Antonio, TX, by fax on May 29,
2003. Firm initiated recall is complete.
REASON
Blood products, which were collected from a donor who may be at increased
risk for variant Creutzfeldt-Jakob Disease (vCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
3 units
DISTRIBUTION
TX

______________________________
PRODUCT
a) Red Blood Cells Leukocytes Reduced, Recall # B-1555-6;
b) Fresh Frozen Plasma, Recall # B-1556-6
CODE
a) and b) Unit 2454970
RECALLING FIRM/MANUFACTURER
South Texas Blood and Tissue Center, San Antonio, TX, by fax on July 23 and
December 11. 2003. Firm initiated recall is complete.
REASON
Blood products, which were collected from a donor who may be at increased
risk for variant Creutzfeldt-Jakob Disease (vCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
2 units
DISTRIBUTION
TX


______________________________
PRODUCT
a) Red Blood Cells, Recall # B-1494-6
b) Cryoprecipitated AHF, Recall # B-1495-6
CODE
a) and b) Unit 5013100
RECALLING FIRM/MANUFACTURER
Walter L. Shepeard Community Blood Center, Inc., Augusta, GA, by fax on May
17, 2005. Firm initiated recall is complete.
REASON
Blood products, which were collected from a donor who may be at increased
risk for variant Creutzfeldt-Jakob Disease (vCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
2 units
DISTRIBUTION
GA


______________________________
PRODUCT
Source Plasma, Recall # B-1450-6
CODE
Unit numbers ST0824313 and ST0824764
RECALLING FIRM/MANUFACTURER
Stillwater Plasma Center LLC, Stillwater, OK, by fax on November 21, 2003.
Firm initiated recall is complete.
REASON
Blood products, which were collected from a donor whose suitability
pertaining to risk factors for Creutzfeldt-Jakob Disease (vCJD) was not
adequately determined, were distributed.
VOLUME OF PRODUCT IN COMMERCE
2 units
DISTRIBUTION
UK


______________________________
PRODUCT
Plasma Frozen, Recall # B-1422-6;
Recovered Plasma, Recall # B-1423-6
CODE
a) Unit 03E42218;
b) Unit 03E38153
RECALLING FIRM/MANUFACTURER
American Red Cross Blood Services, Atlanta, GA, by telephone, e-mail or
letter on February 20 or 21, 2004. Firm initiated recall is complete.
REASON
Blood products, which were collected from a donor who may be at increased
risk for variant Creutzfeldt-Jakob Disease (vCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
2 units
DISTRIBUTION
GA and Switzerland


______________________________
PRODUCT
a) Red Blood Cells Leukocytes Reduced, Recall # B-1374-6;
b) Recovered Plasma, Recall # B-1375-6
CODE
a) and b) unit 2453906
RECALLING FIRM/MANUFACTURER
South Texas Blood and Tissue Center, San Antonio, TX, by fax on October 31
and November 5, 2003. Firm initiated recall is complete.
REASON
Blood products, which were collected from a donor who may be at increased
risk for variant Creutzfeldt-Jakob Disease (vCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
2 units
DISTRIBUTION
TX and Austria


______________________________
PRODUCT
Source Plasma. Recall # B-1295-6
CODE
Units: NG0046551, NG0045950
RECALLING FIRM/MANUFACTURER
DCI Biologicals Nacogdoches LLC, Nacogdoches, TX, by telephone and fax on
December 20, 2002, Firm initiated recall is complete.
REASON
Blood products, collected from a donor who did not answer the questions on
the new variant Creutzfeldt-Jacob disease (nvCJD) questionnaire
appropriately, were distributed.
VOLUME OF PRODUCT IN COMMERCE
2 units
DISTRIBUTION
KY

______________________________
PRODUCT
Source Plasma. Recall # B-1296-6
CODE
Unit: NG 0044520
RECALLING FIRM/MANUFACTURER
DCI Biologicals Nacogdoches LLC, Nacogdoches, TX, by telephone and fax on
December 12, 2002. Firm initiated recall is complete.
REASON
Blood product, collected from a donor who did not answer the questions on
the new variant Creutzfeldt-Jacob disease (nvCJD) questionnaire, was
distributed.
VOLUME OF PRODUCT IN COMMERCE
1 unit
DISTRIBUTION
KY

______________________________
PRODUCT
Source Plasma. Recall # B-1297-6
CODE
Units: NG0042874, NG0043139, NG0043312, NG0043618, NG0043797, NG0044020,
NG0044209, NG0044507, NG0044718, NG0044977, NG0045161, NG0045412, NG0045555
RECALLING FIRM/MANUFACTURER
DCI Biologicals Nacogdoches LLC, Nacogdoches, TX, by telephone and fax on
December 20, 2002. Firm initiated recall is complete.
REASON
Blood products, collected from a donor considered to be at increased risk
for variant Creutzfeldt-Jakob Disease (vCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
13 units
DISTRIBUTION
KY

______________________________
PRODUCT
Source Plasma, Recall # B-1298-6
CODE
Units: NG 0046823, NG 0046671, NG 0045205, NG 0044635, NG 0043095, NG
0042525, NG 0042341
RECALLING FIRM/MANUFACTURER
DCI Biologicals Nacogdoches LLC, Nacogdoches, TX, by telephone and fax on
December 20, 2002. Firm initiated recall is complete.
REASON
Blood products, collected from a donor who answered questions on the variant
Creutzfeldt-Jacob disease (vCJD) questionnaire inappropriately, were
distributed.
VOLUME OF PRODUCT IN COMMERCE
7 units
DISTRIBUTION
KY

______________________________
PRODUCT
Recovered Plasma, Recall # B-1299-6
CODE
Unit: 4357117
RECALLING FIRM/MANUFACTURER
Department of the Navy, Naval Medical Center, San Diego, CA, by fax and
letter on September 25, 2003. Firm initiated recall is complete.
REASON
Blood product, collected from a donor considered to be at risk of exposure
to Creutzfeldt-Jacob Disease (CJD), was distributed.
VOLUME OF PRODUCT IN COMMERCE
1 unit
DISTRIBUTION
Germany


END OF ENFORCEMENT REPORT FOR July 12, 2006

###


http://www.fda.gov/bbs/topics/enforce/2006/ENF00960.html



CJD WATCH MESSAGE BOARD
TSS
FDA mad cow nvCJD 'only' blood recalls 1ST WEEK JULY
Fri Jul 7, 2006 09:37
70.110.83.160


FDA mad cow nvCJD 'only' blood recalls 1ST WEEK JULY


PRODUCT
a) Red Blood Cells Leukocytes Reduced, Recall # B-1379-6;
b) Platelets, Recall # B-1380-6;
c) Fresh Frozen Plasma, Recall # 1381-6;
d) Recovered Plasma, Recall # B-1382-6
CODE
a) Unit numbers: 2343106, 2377779, and 2403533;
b) and c) Unit numbers: 2377779;
d) Unit numbers: 2343106 and 2403533
RECALLING FIRM/MANUFACTURER
South Texas Blood and Tissue Center, San Antonio, TX, by facsimile on June
12, 2003. Firm initiated recall is complete.
REASON
Blood products, which were collected from a donor who may be at increased
risk for variant Creutzfeldt-Jakob Disease (vCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
7 units
DISTRIBUTION
TX and Austria
______________________________



PRODUCT
a) Red Blood Cells Leukocytes Reduced, Recall # B-1467-6;
b) Recovered Plasma, Recall # B-1468-6
CODE
a) and b) Unit numbers: 2329380
RECALLING FIRM/MANUFACTURER
South Texas Blood and Tissue Center, San Antonio, TX, by facsimile on May 8,
2003. Firm initiated recall is complete.
REASON
Blood products, which were collected from a donor who may be at increased
risk for variant Creutzfeldt-Jakob Disease (vCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
2 units
DISTRIBUTION
TX and Switzerland

______________________________


PRODUCT
a) Red Blood Cells Leukocytes Reduced, Recall # B-1479-6;
b) Cryoprecipitated AHF, Recall # B-1480-6;
c) Recovered Plasma, Recall # B-1481-6
CODE
a), b), and c) Unit numbers: 2383280
RECALLING FIRM/MANUFACTURER
South Texas Blood and Tissue Center, San Antonio, TX, by facsimile on July
23 and 29, 2004. Firm initiated recall is complete.
REASON
Blood products, which were collected from a donor who may be at increased
risk for variant Creutzfeldt-Jakob Disease (vCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
3 units
DISTRIBUTION
TX and Switzerland

______________________________
PRODUCT
a) Red Blood Cells Leukocytes Reduced, Recall # B-1482-6;
b) Fresh Frozen Plasma, Recall # B-1483-6
CODE
a) and b) Unit number: 2501452
RECALLING FIRM/MANUFACTURER
South Texas Blood and Tissue Center, San Antonio, TX, by facsimile on
October 5, 2004. Firm initiated recall is complete.
REASON
Blood products, which were collected from a donor who may be at increased
risk for variant Creutzfeldt-Jakob Disease (vCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
2 units
DISTRIBUTION
TX and NY

______________________________
PRODUCT
a) Red Blood Cells Leukocytes Reduced, Recall # B-1484-6;
b) Plasma Cryoprecipitated Reduced, Recall # B-1485-6;
c) Recovered Plasma, Recall # B-1486-6
CODE
a) and c) Unit number: 2554077;
b) Unit number: 2415708
RECALLING FIRM/MANUFACTURER
South Texas Blood and Tissue Center, San Antonio, TX, by facsimile on August
13, 2004. Firm initiated recall is complete.
REASON
Blood products, which were collected from a donor who may be at increased
risk for variant Creutzfeldt-Jakob Disease (vCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
3 units
DISTRIBUTION
TX and Austria


_____________________________________


END OF ENFORCEMENT REPORT FOR July 5, 2006

###


http://www.fda.gov/bbs/topics/enforce/2006/ENF00959.html




Greetings again Dr. Freas et al at FDA,


WITH new atypical TSE in the bovine, in the sheep, goat, and humans,
and the fact that the new BASE TSE in cattle being very very similar to sporadic
CJD, rather than the nvCJD, the fact that now science showing the TSE agent
of the atypical cattle in Japan showing infectivity other than CNS tissue,
the fact that the latest Texas mad cow and the recent Alabama mad cow both
being of the atypical strain, it would seem prudent to include all human TSE
in the blood ban, in my opinion. with sporadic CJD, you have many strains and
or phenotypes, some of which are 'UNKNOWN', so we do not know how this
will transmit, what tissues are infectious and or if blood transmits. that's the bottom
line, however it has been reported that the BASE is more virulent to humans. With
this, and the fact that sporadic CJD has tripled in the past few years or so, i see it
as being prudent to take serious and immediate action ;



PERSPECTIVE

On the Question of Sporadic

or Atypical Bovine SpongiformEncephalopathy and

Creutzfeldt-Jakob Disease


Paul Brown,* Lisa M. McShane,† Gianluigi Zanusso,‡ and Linda Detwiler§


Strategies to investigate the possible existence of sporadic

bovine spongiform encephalopathy (BSE) require

systematic testing programs to identify cases in countries

considered to have little or no risk for orally acquired disease,

or to detect a stable occurrence of atypical cases in

countries in which orally acquired disease is disappearing.

To achieve 95% statistical confidence that the prevalence

of sporadic BSE is no greater than 1 per million (i.e., the

annual incidence of sporadic Creutzfeldt-Jakob disease

[CJD] in humans) would require negative tests in 3 million

randomly selected older cattle. A link between BSE and

sporadic CJD has been suggested on the basis of laboratory

studies but is unsupported by epidemiologic observation.

Such a link might yet be established by the discovery

of a specific molecular marker or of particular combinations

of trends over time of typical and atypical BSE and various

subtypes of sporadic CJD, as their numbers are influenced

by a continuation of current public health measures that

exclude high-risk bovine tissues from the animal and

human food chains. ......


PLEASE READ FULL TEXT ;


http://www.cdc.gov/ncidod/EID/vol12no12/06-0965.htm?s_cid=eid06_0965_e



CDC DR. PAUL BROWN TSE EXPERT COMMENTS 2006


The U.S. Department of Agriculture was quick to assure the public earlier this week that the third case of mad cow disease did not pose a risk to them, but what federal officials have not acknowledged is that this latest case indicates the deadly disease has been circulating in U.S. herds for at least a decade.

The second case, which was detected last year in a Texas cow and which USDA officials were reluctant to verify, was approximately 12 years old.

These two cases (the latest was detected in an Alabama cow) present a picture of the disease having been here for 10 years or so, since it is thought that cows usually contract the disease from contaminated feed they consume as calves. The concern is that humans can contract a fatal, incurable, brain-wasting illness from consuming beef products contaminated with the mad cow pathogen.

"The fact the Texas cow showed up fairly clearly implied the existence of other undetected cases," Dr. Paul Brown, former medical director of the National Institutes of Health's Laboratory for Central Nervous System Studies and an expert on mad cow-like diseases, told United Press International. "The question was, 'How many?' and we still can't answer that."

Brown, who is preparing a scientific paper based on the latest two mad cow cases to estimate the maximum number of infected cows that occurred in the United States, said he has "absolutely no confidence in USDA tests before one year ago" because of the agency's reluctance to retest the Texas cow that initially tested positive.

USDA officials finally retested the cow and confirmed it was infected seven months later, but only at the insistence of the agency's inspector general.

"Everything they did on the Texas cow makes everything USDA did before 2005 suspect," Brown said. ...snip...end


http://www.upi.com/




*** Inherent Challenges in Identifying and Testing High-Risk Cattle Still Remain


http://www.usda.gov/oig/webdocs/50601-10-KC.pdf





3:00 Afternoon Refreshment Break, Poster and Exhibit Viewing in the Exhibit
Hall


3:30 Transmission of the Italian Atypical BSE (BASE) in Humanized Mouse
Models

Qingzhong Kong, Ph.D., Assistant Professor, Pathology, Case Western Reserve
University

Bovine Amyloid Spongiform Encephalopathy (BASE) is an atypical BSE strain
discovered recently in Italy, and similar or different atypical BSE cases
were also reported in other countries. The infectivity and phenotypes of
these atypical BSE strains in humans are unknown. In collaboration with
Pierluigi Gambetti, as well as Maria Caramelli and her co-workers, we have
inoculated transgenic mice expressing human prion protein with brain
homogenates from BASE or BSE infected cattle. Our data shows that about half
of the BASE-inoculated mice became infected with an average incubation time
of about 19 months; in contrast, none of the BSE-inoculated mice appear to
be infected after more than 2 years. ***These results indicate that BASE is
transmissible to humans and suggest that BASE is more virulent than
classical BSE in humans***.

6:30 Close of Day One


http://www.healthtech.com/2007/tse/day1.asp




SEE STEADY INCREASE IN SPORADIC CJD IN THE USA FROM
1997 TO 2006. SPORADIC CJD CASES TRIPLED, with phenotype
of 'UNKNOWN' strain growing. ...


http://www.cjdsurveillance.com/resources-casereport.html


There is a growing number of human CJD cases, and they were presented last
week in San Francisco by Luigi Gambatti(?) from his CJD surveillance
collection.

He estimates that it may be up to 14 or 15 persons which display selectively
SPRPSC and practically no detected RPRPSC proteins.


http://www.fda.gov/ohrms/dockets/ac/06/transcripts/1006-4240t1.htm


http://www.fda.gov/ohrms/dockets/ac/06/transcripts/2006-4240t1.pdf





Prion infections, blood and transfusions

Adriano Aguzzi* and Markus Glatzel


Prion infections lead to invariably fatal diseases of the CNS, including

Creutzfeldt-Jakob disease (CJD) in humans, bovine spongiform

encephalopathy (BSE), and scrapie in sheep. There have been hundreds

of instances in which prions have been transmitted iatrogenically among

humans, usually through neurosurgical procedures or administration of

pituitary tissue extracts. Prions have not generally been regarded as
bloodborne

infectious agents, and case-control studies have failed to identify

CJD in transfusion recipients. Previous understanding was, however,

questioned by reports of prion infections in three recipients of blood

donated by individuals who subsequently developed variant CJD. On

reflection, hematogenic prion transmission does not come as a surprise, as

involvement of extracerebral compartments such as lymphoid organs and

skeletal muscle is common in most prion infections, and prions have been

recovered from the blood of rodents and sheep. Novel diagnostic strategies,

which might include the use of surrogate markers of prion infection, along

with prion removal strategies, might help to control the risk of iatrogenic

prion spread through blood transfusions. ...


snip...



Last, despite all epidemiological evidence to

the contrary, patients who are methionine/valine

heterozygous at codon 129 of the PRNP gene are

susceptible to infection with vCJD prions, which

raises several important questions. Is the virulence

of BSE prions enhanced when passaged

from human to human, as opposed to the

original bovine to human situation? Passaging

experiments of scrapie infectivity between mice

and hamsters indicate that this scenario is highly

plausible.6 Even more importantly, can vCJD

infection of heterozygous individuals establish

a permanent subclinical carrier state? Although

this situation might constitute a best-case

scenario for the infected individuals, it could be

disastrous from an epidemiological viewpoint,

as it might lead to an unrecognized and possibly

self-sustaining epidemic. ...


snip... full text ;


JUNE 2006 VOL 2 NO 6 AGUZZI AND GLATZEL NATURE CLINICAL PRACTICE NEUROLOGY
329

www.nature.com/clinicalpractice/neuro




FDA Fines American Red Cross $4.2 Million (BLOOD CJD)
Fri Sep 8, 2006 20:01
71.248.154.242



FDA Statement
FOR IMMEDIATE RELEASE
Statement
September 8, 2006
Media Inquiries:
301-827-6242
Consumer Inquiries:
888-INFO-FDA



FDA Fines American Red Cross $4.2 Million for Failure to Meet Established
Blood Safety Laws


http://www.fda.gov/cber/talkpapers.htm#arc


snip...

One way the Red Cross erred was by failing to ask donors about travel
history that could increase the chances of having malaria or the human
version of mad cow disease, FDA officials said.

snip...

http://today.reuters.co.uk/news/articlenews.aspx?type=healthNews&storyID=2006-09-08T224834Z_01_N08403053_RTRIDST_0_HEALTH-REDCROSS-DC.XML


http://today.reuters.co.uk/news/articlenews.aspx?type=healthNews&storyID=2006-09-08T224834Z_01_N08403053_RTRIDST_0_HEALTH-REDCROSS-DC.XML&pageNumber=1&imageid=&cap=&sz=13&WTModLoc=NewsArt-C1-ArticlePage1



Greetings again Dr. Freas et al at FDA,


THIS was like closing the barn door after the mad cows got loose. not only the red cross,
but the FDA has failed the public in protecting them from the TSE aka mad cow agent.
TSE agent i.e. bse, base, cwd, scrapie, tme, and any sub strains thereof.
we do not know if these strains will or have transmitted to humans as subclinical TSE or clinical
disease, and we do not know if they have or will transmit second, third, forth passage via
friendly fire i.e. multiple potential routes via medical, surgical, pharmaceutical etc.

IF you remember correctly Dr. Freas et al, i called this long ago, almost 6 years ago ;


PDF]Freas, William TSS SUBMISSION

File Format: PDF/Adobe Acrobat -

Page 1. J Freas, William From: Sent: To: Subject: Terry S. Singeltary

Sr. [[email protected]] Monday, January 08,200l 3:03 PM freas ...



Freas, William

From: Terry S. Singeltary Sr. [[email protected]]

Sent: Monday, January 08,200l 3:03 PM

To: [email protected]

Subject: CJDIBSE (aka madcow) Human/Animal TSE’s--U.S.--Submission To Scientific Advisors and

Consultants Staff January 2001 Meeting (short version)



Greetings again Dr. Freas and Committee Members,



I wish to submit the following information to the

Scientific Advisors and Consultants Staff

2001 Advisory Committee (short version).

I understand the reason of having to shorten my submission,

but only hope that you add it to a copy of the long version,

for members to take and read at their pleasure,

(if cost is problem, bill me, address below).

So when they realize some time in the near future

of the 'real' risks i speak of from human/animal TSEs and

blood/surgical products. I cannot explain the 'real' risk

of this in 5 or 10 minutes at some meeting,

but will attempt here:

remember AIDS/HIV, 'no problem to heterosexuals in the U.S.?

no need to go into that, you know of this blunder:

DO NOT make these same stupid mistakes again with

human/animal TSE's aka MADCOW DISEASE. I lost my Mom to hvCJD,

and my neighbor lost his Mother to sCJD as well (both cases

confirmed). I have seen many deaths, from many diseases.

I have never seen anything as CJD, I still see my Mom laying helpless,

jerking tremendously, and screaming "God, what's wrong

with me, why can't I stop this". I still see this, and will

never forget. Approximately 10 weeks from 1st of symptoms to death.

This is what drives me. I have learned more in 3 years about not only

human/animal TSE's but the cattle/rendering/feeding industry/government

than i ever wished to.

I think you are all aware of CJD vs vCJD, but i don't think

you all know the facts of human/animal TSE's as a whole,

they are all very very similar, and are all tied to the

same thing, GREED and MAN.

I am beginning to think that the endless attempt to track

down and ban, potential victims from known BSE Countries

from giving blood will be futile. You would have to ban

everyone on the Globe eventually? AS well, I think we

MUST ACT SWIFTLY to find blood test for TSE's,

whether it be blood test, urine test, eyelid test,

anything at whatever cost, we need a test FAST.

DO NOT let the incubation time period of these TSEs fool you.

To think of Scrapie as the prime agent to compare CJD,

but yet overlook the Louping-ill vaccine event in 1930's

of which 1000's of sheep where infected by scrapie

from a vaccine made of scrapie infected sheep brains,

would be foolish. I acquired this full text version of the

event which was recorded in the Annual Congress of 1946

National Vet. Med. Ass. of Great Britain and Ireland.

From the BVA and the URL is posted in my (long version).

U.S.A. should make all human/animal TSE's notifiable at all ages,

with requirements for a thorough surveillance and post-mortem

examinations free of charge, if you are serious about eradicating

this horrible disease in man and animal.

There is histopathology reports describing "florid plaques"

in CJD victims in the USA and some of these victims are getting

younger. I have copies of such autopsies, there has to

be more. PLUS, sub-clinical human TSE's will most definitely

be a problem.

THEN think of vaccineCJD in children and the bovine tissues

used in the manufacturing process, think of the FACT that

this agent surviving 6OO*C.

PNAS -- Brown et al. 97 (7): 3418 scrapie agent live at 600*C

Then think of the CONFIDENTIAL documents of what was known of

human/animal TSE and vaccines in the mid to late 8Os, it was all about

depletion of stock, to hell with the kids, BUT yet they knew.

To think of the recall and worry of TSE's from the polio vaccine,

(one taken orally i think?), but yet neglect to act on the

other potential TSE vaccines (inoculations, the most effective mode to

transmit TSEs) of which thousands of doses were kept and used,

to deplete stockpile, again would be foolish.

--Oral polio; up to 1988, foetal calf serum was used from UK and

New Zealand (pooled); since 1988 foetal calf serum only from New

Zealand. Large stocks are held.

--Rubella; bulk was made before 1979 from foetal calf serum from UK

and New Zealand. None has been made as there are some 15 years stock.

--Diphtheria; UK bovine beef muscle and ox heart is used but since the

end of 1988 this has been sourced from Eire. There are 1,250 litres of

stock.

. .

--Tetanus; this involves bovine material from the UK mainly Scottish.

There are 21,000 litres of stock.

--Pertussis; uses bovine material from the UK. There are 63,000 litres

of stock.

--They consider that to switch to a non-UK source will take a minimum of

6-18 months and to switch to a non-bovine source will take a minimum of

five years.

3. XXXXXXXXXXX have measles, mumps, MMR, rubella vaccines. These

are sourced from the USA and the company believes that US material only

is used.

89/2.14/2.1

============

BSE3/1 0251

4. XXXXXXXXXXX have a measles vaccine using bovine serum from the UK.

there are 440,000 units of stock. They have also got MMR using bovine

serum from the UK.

5. XXXXXXXXXXX have influenza, rubella, measles,' MMR vaccines

likely to be used in children. Of those they think that only MMR

contains bovine material which is probably a French origin.

6. XXXXXXXXXXX have diphtheria/tetanus and potasses on clinical trial.

hese use veal material, some of which has come from the UK and has been

ade by XXXXXXXXXXX (see above).

I have documents of imports from known BSE Countries,

of ferments, whole blood, antiallergenic preparations,

2

human blood plasma, normal human blood sera, human immune

blood sera, fetal bovine serum, and other blood fractions

not elsewhere specified or included, imported glands,

catgut, vaccines for both human/animal, as late as 1998.

Let us not forget about PITUITARY EXTRACT. This was used to help COWS

super ovulate. This tissue was considered to be of greatest risk of

containing BSE and consequently transmitting the disease.

ANNEX 6

MEETING HELD ON 8 JUNE 1988 TO DISCUSS THE IMPLICATIONS OF BSE TO

BIOLOGICAL PRODUCTS CONTAINING BOVINE - EXTRACTED MATERIAL



How much of this was used in the U.S.?

Please do not keep making the same mistakes.

'Absence of evidence is not evidence of absence'.

What are the U.S. rules for importing and manufacturing vaccines,

medicines and medical devices?

Does the U.S.A. allow sourcing of raw material of ruminants from

the U.S.A.?

U.S. cattle, what kind of guarantee can you give for serum or

tissue donor herds.?

The U.S. rendering system would easily amplify T.S.E.'s:

Have we increased the stability of the system (improved heat treatments)

since the EU SSC report on the U.S.A. was published

in july 2000?

What is done to avoid cross-contaminations in the U.S.A.?

How can the U.S. control absence of cross-contaminations of animal

TSE's when pig and horse MBM and even deer and elk are allowed in

ruminant feed, as well as bovine blood? I sadly think of the rendering

and feeding policy before the Aug. 4, 1997 'partial'

feed ban, where anything went, from the city police horse, to the circus

elephant, i will not mention all the scrapie infected sheep.

I am surprised that we have not included man 'aka soyent green'.

It is a disgusting industry and nothing more than greed fuels it.

When will the U.S.. start real surveillance of the U.S. bovine

population (not passive, this will not work)?

When will U.S. start removing SRMs?

Have they stopped the use of pneumatic stunners in the U.S.?

If so, will we stop it in all U.S. abattoirs or only in those

abattoirs exporting to Europe?

If not, WHY NOT?

same questions for removal of SRM in the U.S.A.,

or just for export?

If not, WHY NOT?

How do we now sterilize surgical/dental instruments in the U.S.A.?

Where have we been sourcing surgical catgut?

(i have copies of imports to U.S., and it would floor you)

When will re-usable surgical instruments be banned?

'Unregulated "foods" such as 'nutritional supplements' containing various

extracts from ruminants, whether imported or derived from

US cattle/sheep/cervids ("antler velvet" extracts!) should be

forbidden or at least very seriously regulated.

(neighbors Mom, whom also died from CJD, had been taking

bovine based supplement, which contained brain, eye, and many

other bovine/ovine tissues for years, 'IPLEX').

What is the use of banning blood or tissue donors from Germany, France,

etc... when the U.S.A. continues exposing cattle, sheep and people to

SRM, refuses to have a serious feed ban, refuses

to do systematic BSE-surveillance?

The FDA should feel responsible for the safety of what people eat.

prohibit the most dangerous foods, not only prohibit a few more donors,

the FDA should be responsible for the safe sourcing of medical devices,

not only rely on banning donors "from Europe",

The 'real' risks are here in the U.S. as well, and have been for some

time.

We must not forget the studies that have proven

infectivity in blood from TSE's.



The Lancet, November 9, 1985

" Sir, --Professor Manuelidis and his colleagues (Ott 19, p896) report

transmission to animals of Creutzfeldt-Jakob disease (CJD) from the

buffy coat from two patients. We also transmitted the disease from ,

whole blood samples of a patient (and of mice) infected with CJD.l

Brain, Cornea, and urine from this patient were also infectious,

and the clinicopathological findings2 are summarised as follows.

snip...


full text ;


http://www.fda.gov/ohrms/dockets/ac/01/slides/3681s2_09.pdf



Greetings again Dr. Freas et al at FDA,



NOW, here we are in 2006, worried and still fumbling around with what should have been
done long, long ago ;



Subject: 91ST MEETING OF THE SEAC MEETING LONDON 24TH FEB 2006
Date: March 10, 2006 at 7:36 am PST
1

© SEAC 2006

NINETY FIRST MEETING OF THE SPONGIFORM

ENCEPHALOPATHY ADVISORY COMMITTEE

The Spongiform Encephalopathy Advisory Committee held its 91st

meeting in London on 24th February 2006.



snip...



MEDICAL IMPLANTS CONTAINING BOVINE MATERIAL

SEAC considered the risk to human health from medical implants

that include bovine material sourced from the USA. This material

was used for a wide range of medical devices, some of which are

life saving and for which there are no alternative products.

SEAC considered that the source of the animal was crucial to

manage the risk. The committee suggested that other

precautionary steps be taken where practicable, such as using

material from young animals, sourcing material from countries with

good surveillance procedures and a low prevalence of disease. ......



snip...



http://www.seac.gov.uk/minutes/final90.pdf



A BIT OF HISTORY ON THIS TOPIC



TWA LITTLE minute


http://www.bseinquiry.gov.uk/files/yb/1988/06/10001001.pdf


http://www.bseinquiry.gov.uk/files/yb/1988/06/13010001.pdf


http://www.bseinquiry.gov.uk/files/yb/1988/06/14006001.pdf


COMMERCIAL IN CONFIDENCE


http://www.bseinquiry.gov.uk/files/yb/1988/09/06005001.pdf

http://www.bseinquiry.gov.uk/files/yb/1988/10/06005001.pdf


NOT FOR PUBLICATION


http://www.bseinquiry.gov.uk/files/yb/1988/11/01012001.pdf


http://www.bseinquiry.gov.uk/yb/1988/11/04003001.pdf


http://www.bseinquiry.gov.uk/files/yb/1988/04/00007001.pdf


http://www.bseinquiry.gov.uk/files/yb/1988/07/00007001.pdf


http://www.bseinquiry.gov.uk/files/yb/1988/09/00004001.pdf


http://www.bseinquiry.gov.uk/files/yb/1988/10/00003001.pdf


http://www.bseinquiry.gov.uk/files/yb/1989/01/04001001.pdf


http://www.bseinquiry.gov.uk/files/yb/1989/01/26007001.pdf


http://www.bseinquiry.gov.uk/files/yb/1989/01/30001001.pdf


http://www.bseinquiry.gov.uk/files/yb/1989/09/06011001.pdf



NON-LICENSED HUMAN TISSUE DEVICES WERE NOT COMMERCIALLY AVAILABLE


snip...

I was quite prepared to believe in unofficial pituitary hormones, also in the 1970's, whether as described by Dr. Little, or in other circumstances, for animal use.

snip...

The fact that there were jars of pituitaries (or extract) around on shelves is attested by the still potent 1943 pituitaries, described in Stockell Hartree et al. (J/RF/17/291) which had come from the lab. at Mill Hill. Having taken the trouble to collect them, they were not lightly thrown out...


http://www.bseinquiry.gov.uk/files/ws/s467bx.pdf


more on the 1968 medicine act, they forgot to follow


http://www.bseinquiry.gov.uk/files/yb/1989/01/30008001.pdf


8. The Secretary of State has a number of licences. We understand that
the inactivated polio vaccine is no longer being used. There is a stock
of smallpox vaccine. We have not been able to determine the source
material. (Made in sheep very unlikely to contain bovine ingredients).

http://www.bseinquiry.gov.uk/files/yb/1989/02/14010001.pdf


http://www.bseinquiry.gov.uk/files/yb/1989/02/14011001.pdf


although 176 products do _not_ conform to the CSM/VPC
guidelines.


http://www.bseinquiry.gov.uk/files/yb/1989/09/06011001.pdf


Draft cover letter to product licence holders (considered by Human and Vet Medicines including deer)


http://www.bseinquiry.gov.uk/files/yb/1989/02/22008001.pdf


http://www.bseinquiry.gov.uk/files/yb/1989/02/22011001.pdf


(It was noted with concern that hormone extracts could be manufactured by a veterinary surgeon for administration to animals under his care without any Medicines Act Control.)


http://www.bseinquiry.gov.uk/files/yb/1988/06/08011001.pdf


http://www.bseinquiry.gov.uk/files/yb/1988/06/08011001.pdf


http://www.bseinquiry.gov.uk/files/yb/1988/06/07010001.pdf


TWA LITTLE STATEMENT 331


http://www.bseinquiry.gov.uk/files/ws/s331.pdf






WE know about USA serum and tissue donor herds from the now infamous

Jan. 9, 2001 FDA emergency 50 state BSE conference call, that in fact, USA serum

and tissue donor herds were eating banned ruminant feed as well ;





Date: Sun, 7 Jan 2001 09:45:19 -0800
Reply-To: Sustainable Agriculture Network Discussion Group
<[log in to unmask]>
Sender: Sustainable Agriculture Network Discussion Group
<[log in to unmask]>
From: Beth von Gunten <[log in to unmask]>
Subject: [BSE] FDA/IMPORTANT NOTICE: 50 STATE CONFERENCE CALL


IMPORTANT NOTICE: 50 STATE CONFERENCE CALL - BSE



TUESDAY, JANUARY 9, 2001
1:00-2:00 PM EST CALL: 1-888-273-9887



A special "50 STATE CONFERENCE CALL" to discuss BSE (Bovine
Spongiform Encephalopathy) issues for Food and Drug Administration
(FDA) regulated animal feed products in the United States and
imported animal feeds. The conference call will
discuss the FDA proposed response to the current BSE issue and the
assistance needed from state feed and agriculture programs. THIS
ISSUE MAY IMPACT ALL STATES AND ALL ANIMAL FEED AND PRODUCTION
INDUSTRIES.

The 50 State call is scheduled for Tuesday, January 9, 2001 from
1:00-2:00 pm EST. Any state agency responsible for animal feed issues
wishing to participate should call 1-888-273-9887 and ask to be
connected to the "50 State BSE Call". The conference host operator
will explain how to participate, including asking questions during
the call. If possible, please coordinate within your state to utilize
only one phone line per state agency.

We request that you forward this message to your agency management
and feed coordinators or other agencies or departments who may be
responsible for any animal feed issues related to FDA regulated
products.

The agenda will be as follows:

1. Center For Veterinary Medicine (FDA) - Discussion of the problem
related to BSE events in Europe and the impact on US feed ingredients
for animals and feed operations. Discussion of the proposed
actions/inspections/compliance of licensed and unlicensed feed mills,
commercial feed manufacturers, animal feed imports, renderer's,
protein blenders, on-farm mixers, and ruminant feeders.

2. Office of Regional Operations (FDA) - Discussion of
contracting/working with states to inspect the universe of feed
mills/industry for "Animal Proteins Prohibited from Use in Animal
Feed". Discussion of working with FDA field offices.

3. Questions and answers.

Richard H. Barnes, Director
Division of Federal-State Relations (HFC-150)
5600 Fishers Lane Room 1207
Rockville, Md. 20857
ph: (301) 827-6906 FAX: (301) 443-2143
Email: [log in to unmask]

http://lists.ifas.ufl.edu/cgi-bin/wa.exe?A2=ind0101&L=sanet-mg&P=13410 Subject: BSE--U.S. 50 STATE CONFERENCE CALL Jan. 9, 2001 Date: Tue, 9 Jan 2001 16:49:00 -0800 From: "Terry S. Singeltary Sr." Reply-To: Bovine Spongiform Encephalopathy To: [email protected] ######### Bovine Spongiform Encephalopathy ######### Greetings List Members, I was lucky enough to sit in on this BSE conference call today and even managed to ask a question. that is when the trouble started. I submitted a version of my notes to Sandra Blakeslee of the New York Times, whom seemed very upset, and rightly so. "They tell me it is a closed meeting and they will release whatever information they deem fit. Rather infuriating." and i would have been doing just fine, until i asked my question. i was surprised my time to ask a question so quick. (understand, these are taken from my notes for now. the spelling of names and such could be off.) [host Richard Barns] and now a question from Terry S. Singeltary of CJD Watch. [TSS] yes, thank you, U.S. cattle, what kind of guarantee can you give for serum or tissue donor herds? [no answer, you could hear in the back ground, mumbling and 'we can't. have him ask the question again.] [host Richard] could you repeat the question? [TSS] U.S. cattle, what kind of guarantee can you give for serum or tissue donor herds? [not sure whom ask this] what group are you with? [TSS] CJD Watch, my Mom died from hvCJD and we are tracking CJD world-wide. [not sure who is speaking] could you please disconnect Mr. Singeltary [TSS] you are not going to answer my question? [not sure whom speaking] NO from this point, i was still connected, got to listen and tape the whole conference. at one point someone came on, a woman, and ask again; [unknown woman] what group are you with? [TSS] CJD Watch and my Mom died from hvCJD we are trying to tract down CJD and other human TSE's world wide. i was invited to sit in on this from someone inside the USDA/APHIS and that is why i am here. do you intend on banning me from this conference now? at this point the conference was turned back up, and i got to finish listening. They never answered or even addressed my one question, or even addressed the issue. BUT, i will try and give you a run-down for now, of the conference. IF i were another Country, I would take heed to my notes, BUT PLEASE do not depend on them. ask for transcript from; [email protected] 301-827-6906 he would be glad to give you one ;-) Rockville Maryland, Richard Barns Host BSE issues in the U.S., How they were labelling ruminant feed? Revising issues. The conference opened up with the explaining of the U.K. BSE epidemic winding down with about 30 cases a week. although new cases in other countries were now appearing. Look at Germany whom said NO BSE and now have BSE. BSE increasing across Europe. Because of Temporary Ban on certain rendered product, heightened interest in U.S. A recent statement in Washington Post, said the New Administration (old GW) has a list of issues. BSE is one of the issues. BSE Risk is still low, minimal in U.S. with a greater interest in MBM not to enter U.S. HOWEVER, if BSE were to enter the U.S. it would be economically disastrous to the render, feed, cattle, industries, and for human health. (human health-they just threw that in cause i was listening. I will now jot down some figures in which they told you, 'no need to write them down'. just hope i have them correct. hmmm, maybe i hope i don't ???) 80% inspection of rendering *Problem-Complete coverage of rendering HAS NOT occurred. sizeable number of 1st time FAILED INITIAL INSPECTION, have not been reinspected (70% to 80%). Compliance critical, Compliance poor in U.K. and other European Firms. Gloria Dunason Major Assignment 1998 goal TOTAL compliance. This _did not_ occur. Mixed level of compliance, depending on firm. Rendering FDA license and NON FDA license system in place for home rendering & feed 76% in compliance 79% cross contamination 21% DID NOT have system 92% record keeping less than 60% total compliance 279 inspectors 185 handling prohibited materials Renderer at top of pyramid, significant part of compliance. 84% compliance failed to have caution statement render 72% compliance & cross contamination caution statement on feed, 'DO NOT FEED TO CATTLE' 56 FIRMS NEVER INSPECTED 1240 FDA license feed mills 846 inspected "close to 400 feed mills have not been inspected" 80% compliance for feed. 10% don't have system. NON-FDA licensed mills There is NO inventory on non licensed mills. approximately 6000 to 8000 Firms ??? 4,344 ever inspected. "FDA does not have a lot of experience with" 40% do NOT have caution statement 'DO NOT FEED'. 74% Commingling compliance "This industry needs a lot of work and only half gotten to" "700 Firms that were falitive, and need to be re-inspected, in addition to the 8,000 Firms." Quote to do BSE inspection in 19 states by end of January or 30 days, and other states 60 days. to change feed status??? Contract check and ask questions and pass info. At this time, we will take questions. [I was about the third or fourth to ask question. then all B.S.eee broke loose, and i lost my train of thought for a few minutes. picked back up here] someone asking about nutritional supplements and sourcing, did not get name. something about inspectors not knowing of BSE risk??? the conference person assuring that Steve Follum? and the TSE advisory Committee were handling that. Some other Dr. Vet, whom were asking questions that did not know what to do??? [Dennis Wilson] California Food Agr. Imports, are they looking at imports? [Conference person] they are looking at imports, FDA issued imports Bulletin. [Linda Singeltary ??? this was a another phone in question, not related i don't think] Why do we have non-licensed facilities? (conference person) other feed mills do not handle as potent drugs??? Dennis Blank, Ken Jackson licensed 400 non FDA 4400 inspected of a total of 6000 to 8000, (they really don't know how many non licensed Firms in U.S. they guess 6000 to 8000??? TSS) Linda Detwiler asking everyone (me) not to use emergency BSE number, unless last resort. (i thought of calling them today, and reporting the whole damn U.S. cattle herd ;-) 'not' Warren-Maryland Dept. Agr. Prudent to re-inspect after 3 years. concerned of Firms that have changed owners. THE END TSS ############ http://mailhost.rz.uni-karlsruhe.de/warc/bse-l.html ############ FROM New York TIMES Subject: Re: BSE 50 STATE CONFERENCE CALL thread from BSE List and FDA Posting of cut version... Date: Thu, 11 Jan 2001 22:02:47 -0700 From: "Sandy Blakeslee" To: "Terry S. Singeltary Sr." References: 1 Hi terry -- thanks for all your help. I know it made a difference with the FDA getting out that release. ----- Original Message ----- From: "Terry S. Singeltary Sr." To: Sent: Thursday, January 11, 2001 2:06 PM Subject: BSE 50 STATE CONFERENCE CALL thread from BSE List and FDA
----- Original Message ----- From: "Terry S. Singeltary Sr." To: Sent: Thursday, January 11, 2001 2:06 PM Subject: BSE 50 STATE CONFERENCE CALL thread from BSE List and FDA > hi sandy, >From the New York Times NYTimes.com, January 11, 2001 Many Makers of Feed Fail to Heed Rules on Mad Cow Disease By SANDRA BLAKESLEE Large numbers of companies involved in manufacturing animal feed are not complying with regulations meant to prevent the emergence and spread of mad cow disease in the United States, the Food and Drug Administration said yesterday. The widespread failure of companies to follow the regulations, adopted in August 1997, does not mean that the American food supply is unsafe, Dr. Stephen Sundlof, director of the Center for Veterinary Medicine at the F.D.A., said in an interview. But much more needs to be done to ensure that mad cow disease does not arise in this country, Dr. Sundlof said. The regulations state that feed manufacturers and companies that render slaughtered animals into useful products generally may not feed mammals to cud-chewing animals, or ruminants, which can carry mad cow disease. All products that contain rendered cattle or sheep must have a label that says, "Do not feed to ruminants," Dr. Sundlof said. Manufacturers must also have a system to prevent ruminant products from being commingled with other rendered material like that from chicken, fish or pork. Finally, all companies must keep records of where their products originated and where they were sold. Under the regulations, F.D.A. district offices and state veterinary offices were required to inspect all rendering plants and feed mills to make sure companies complied. But results issued yesterday demonstrate that more than three years later, different segments of the feed industry show varying levels of compliance. Among 180 large companies that render cattle and another ruminant, sheep, nearly a quarter were not properly labeling their products and did not have a system to prevent commingling, the F.D.A. said. And among 347 F.D.A.-licensed feed mills that handle ruminant materials - these tend to be large operators that mix drugs into their products - 20 percent were not using labels with the required caution statement, and 25 percent did not have a system to prevent commingling. Then there are some 6,000 to 8,000 feed mills so small they do not require F.D.A. licenses. They are nonetheless subject to the regulations, and of 1,593 small feed producers that handle ruminant material and have been inspected, 40 percent were not using approved labels and 25 percent had no system in place to prevent commingling. On the other hand, fewer than 10 percent of companies, big and small, were failing to comply with the record-keeping regulations. The American Feed Industry Association in Arlington, Va., did not return phone calls seeking comment. http://www.nytimes.com/2001/01/11/science/11COW.html Subject: USDA/APHIS response to BSE-L--U.S. 50 STATE CONFERENCE CALL Jan. 9, 2001 Date: Wed, 10 Jan 2001 14:04:21 -0500 From: "Gomez, Thomas M." Reply-To: Bovine Spongiform Encephalopathy To: [email protected] ######### Bovine Spongiform Encephalopathy ######### USDA/APHIS would like to provide clarification on the following point from Mr. Singeltary's 9 Jan posting regarding the 50 state conference call. [Linda Detwiler asking everyone (me) not to use emergency BSE number, unless last resort. (i thought of calling them today, and reporting the whole damn U.S. cattle herd ;-) 'not'] Dr. Detwiler was responding to an announcement made during the call to use the FDA emergency number if anyone wanted to report a cow with signs suspect for BSE. Mr. Singeltary is correct that Dr. Detwiler asked participants to use the FDA emergency number as a last resort to report cattle suspect for BSE. What Mr. Singeltary failed to do was provide the List with Dr. Detwiler's entire statement. Surveillance for BSE in the United States is a cooperative effort between states, producers, private veterinarians, veterinary hospitals and the USDA. The system has been in place for over 10 years. Each state has a system in place wherein cases are reported to either the State Veterinarian, the federal Veterinarian in Charge or through the veterinary diagnostic laboratory system. The states also have provisions with emergency numbers. Dr. Detwiler asked participants to use the systems currently in place to avoid the possibility of a BSE-suspect report falling through the cracks. Use of the FDA emergency number has not been established as a means to report diseased cattle of any nature. ############ http://mailhost.rz.uni-karlsruhe.de/warc/bse-l.html ############ Subject: Re: USDA/APHIS response to BSE-L--U.S. 50 STATE CONFERENCE CALL Jan.9, 2001 Date: Wed, 10 Jan 2001 13:44:49 -0800 From: "Terry S. Singeltary Sr." Reply-To: Bovine Spongiform Encephalopathy To: [email protected] References: 1 ######### Bovine Spongiform Encephalopathy ######### Hello Mr. Thomas, > What Mr. Singeltary failed to do was provide > the List with Dr. Detwiler's entire statement. would you and the USDA/APHIS be so kind as to supply this list with a full text version of the conference call and or post on your web-site? if so when, and thank you. if not, why not? > The system has been in place for over 10 years. that seems to be a very long time for a system to be in place, and only test 10,700 cattle from some 1.5 BILLION head (including calf crop). Especially since French are testing some 20,000 weekly and the E.U. as a whole, are testing many many more than the U.S., with less cattle, same risk of BSE/TSEs. Why does the U.S. insist on not doing massive testing with the tests which the E.U. are using? Why is this, please explain? Please tell me why my question was not answered? > U.S. cattle, what kind of guarantee can you > give for serum or tissue donor herds? It was a very simple question, a very important question, one that pertained to the topic of BSE/feed, and asked in a very diplomatic way. why was it not answered? If all these years, we have been hearing that pharmaceutical grade bovines were raised for pharmaceuticals vaccines etc. But yet the USA cannot comply with feed regulations of the ruminant feed ban, PLUS cannot even comply with the proper labelling of the feed, cross contamination etc. Then how in the world can you Guarantee the feed fed to pharmaceutical grade bovine, were actually non ruminant feed? Before i was ask to be 'disconnected', i did hear someone in the background say 'we can't'-- have him ask the question again. could you please be so kind, as to answer these questions? thank you, Terry S. Singeltary Sr. Bacliff, Texas USA P.S. if you will also notice, i did not post that emergency phone number and do not intend on passing it on to anyone. I was joking when i said i should call and report the whole damn U.S. Herd. So please pass that on to Dr. Detwiler, so she can rest easily. BUT, they should be reported, some are infected with TSE. The U.S. is just acting as stupid as Germany and other Countries that insist they are free of BSE. TSS Subject: Report on the assessment of the Georgraphical BSE-risk of the USA July 2000 (not good) Date: Wed, 17 Jan 2001 21:23:51 -0800 From: "Terry S. Singeltary Sr." Reply-To: Bovine Spongiform Encephalopathy To: [email protected] ######### Bovine Spongiform Encephalopathy ######### Greetings List Members and ALL EU Countries, Because of this report, and the recent findings of the 50-state BSE Conference call, I respectfully seriously suggest that these Countries and the SSC re-evaluate the U.S.A. G.B.R. to a risk factor of #3. snip... Terry S. Singeltary Sr., P.O. Box 42, Bacliff, Texas USA 77518 http://www.fda.gov/ohrms/dockets/dailys/03/Jan03/012403/8004be07.html CVM Update<<Back January 10, 2001 UPDATE ON RUMINANT FEED (BSE) ENFORCEMENT ACTIVITIESBovine spongiform encephalopathy (BSE) is a type of “transmissible spongiform encephalopathy” disease that infects cattle. After the first case in 1986 in the United Ki
 

flounder

Well-known member
----- Original Message -----
From: "Terry S. Singeltary Sr." <[email protected]>
To: <[email protected]>
Sent: Thursday, December 28, 2006 12:40 PM
Subject: MAD COW BLOOD AND TISSUE RECALLS FOR HUMANS COMPLIMENTS FDA ET AL END OF ENFORCEMENT REPORT FOR DECEMBER 27, 2006


PRODUCT
Red Blood Cells, Leukocytes Reduced, Recall # B-0456-7
CODE
Unit number 5213589
RECALLING FIRM/MANUFACTURER
Oklahoma Blood Institute, Sylvan N. Goldman Center, Oklahoma City, OK, by facsimile dated March18, 2005. Firm initiated recall is complete.
REASON
Blood product, which was collected from an unsuitable donor based on risk factors for variant Creutzfeldt-Jakob Disease (vCJD), was distributed.
VOLUME OF PRODUCT IN COMMERCE
1 unit
DISTRIBUTION
OK
______________________________
PRODUCT
a) Red Blood Cells, Leukocytes Reduced, Recall # B-0459-7;
b) Recovered Plasma, Recall # B-0460-7
CODE
a) and b) Unit: 4765590
RECALLING FIRM/MANUFACTURER
Oklahoma Blood Institute, Sylvan N. Goldman Center, Oklahoma City, OK, by facsimile dated April 5, 2005. Firm initiated recall is complete.
REASON
Blood products, which were collected from an unsuitable donor based on risk factors for variant Creutzfeldt-Jakob Disease (vCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
2 units
DISTRIBUTION
Oklahoma and Switzerland

______________________________
PRODUCT
a) Red Blood Cells, Leukocytes Reduced, Recall # B-0461-7;
b) Recovered Plasma, Recall # B-0462-7
CODE
a) and b) Unit number 4900925
RECALLING FIRM/MANUFACTURER
Oklahoma Blood Institute, Sylvan N. Goldman Center, Oklahoma City, OK, by facsimile dated March 11, 2005. Firm initiated recall is complete.
REASON
Blood products, which were collected from an unsuitable donor based on risk factors for variant Creutzfeldt-Jakob Disease (vCJD), were distributed
VOLUME OF PRODUCT IN COMMERCE
2 units
DISTRIBUTION
Oklahoma and Switzerland

______________________________
PRODUCT
a) Red Blood Cells, Leukocytes Reduced, Recall # B-0463-7;
b) Recovered Plasma, Recall # B-0464-7
CODE
a) and b) Unit number 5253844
RECALLING FIRM/MANUFACTURER
Oklahoma Blood Institute, Sylvan N. Goldman Center, Oklahoma City, OK, by facsimile dated July 7, 2005. Firm initiated recall is complete.
REASON
Blood products, which were collected from an unsuitable donor based on risk factors for variant Creutzfeldt-Jakob Disease (vCJD), were distributed
VOLUME OF PRODUCT IN COMMERCE
2 units
DISTRIBUTION
Oklahoma and Switzerland

______________________________
PRODUCT
a) Red Blood Cells, Recall # B-0474-7;
b) Recovered Plasma, Recall # B-0475-7
CODE
a) and b) Unit: 0249958
RECALLING FIRM/MANUFACTURER
The Blood Center, New Orleans, LA, by telephone and facsimile beginning July 20, 2005. Firm initiated recall is complete.
REASON
Blood products, collected from a donor who was at increased risk for new variant Creutzfeldt-Jakob Disease (nvCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
2 units
DISTRIBUTION
CA and LA

______________________________
PRODUCT
a) Red Blood Cells, Recall # B-0481-7;
b) Platelets, Recall # B-0482-7;
c) Fresh Frozen Plasma, Recall # B-0483-7
CODE
a), b), and c) Unit 0253260
RECALLING FIRM/MANUFACTURER
The Blood Center, New Orleans, LA, by telephone and facsimile beginning July 25, 2005. Firm initiated recall is complete.
REASON
Blood products, collected from a donor who may have been at increased risk for new variant Creutzfeldt-Jakob Disease (nvCJD), were distributed.
VOLUME OF PRODUCT IN COMMERCE
3 units
DISTRIBUTION
CA and LA



===========================================================



RECALLS AND FIELD CORRECTIONS: BIOLOGICS -- CLASS I
______________________________
PRODUCT
Human Tissue for Transplantation:
a) Achilles Tendon Frozen;
b) Patellar Ligament Hemi, Frozen;
c) Cartilage in Saline Vacuum;
d) Tibialis Anterior Tendon, Frozen
e) Tibialis Tendon Frozen;
f) Tibialis Tendon Posterior Frozen;
Recall # B-0114-7;
a) Fascia Lyo 101-150 sq cm;
b) Pericardium Lyo 26-50 sq cm;
c) ) Semitendonosus / Gracilis Frozen;
d) Patella Ligament Whole Frozen,
Recall # B-0115-7
CODE
a) 03-0178792, 03-0173682, 03-0168103, 03-0168104, 03-0162640, 03-0168841, 03-0181591, 03-0168302, 03-0179205, 03-0181592, 03-0042572, 03-0155372, 03-0182234, 03-0032401, 03-0174931, 03-0155371, 03-0161144, 03-0182782, 03-0182623, 03-0181628, 03-0182051, 03-0032400, 03-0168301, 03-0147962, 03-0173822, 03-0182235, 03-0181627, 03-0128130, 03-0162639, 03-0182783, 03-0182624, 03-0161143, 03-0182052, 03-0151503, 03-0147961, 03-0042571, 03-0179206, 03-0172621, 03-0135831, 03-0174932, 03-0173821, 03-0173681, 03-0172251, 03-0178791, 03-0173841, 03-0173842;
b) 03-0168842, 03-0181593, 03-0135832, 03-0181595, 03-0182781, 03-0178796, 03-0182625, 03-0182626, 03-0168844, 03-0173823, 03-0173825, 03-0179203, 03-0173826, 03-0182011, 03-0182049, 03-0179202, 03-0042574, 03-0139081, 03-0151502, 03-0147967, 03-0168102, 03-0162641, 03-0161142, 03-0128132, 03-0042575, 03-0168101, 03-0172618, 03-0181594, 03-0162643, 03-0168843, 03-0181438, 03-0172252, 03-0181596, 03-0178793, 03-0178794, 03-0032405, 03-0139084, 03-0179204, 03-0182047, 03-0181212, 03-0172620, 03-0182048, 03-0172617, 03-0172619, 03-0042573, 03-0042576, 03-0178795, 03-0139082, 03-0162644, 03-0173824, 03-0181213, 03-0172253, 03-0182050, 03-0151501, 03-0179201, 03-0181436, 03-0181437, 03-0032402, 03-00324404, 03-0162642, 03-0128131, 03-0128133, 03-0147968, 03-0181211;
c) 03-0014874, 03-0014871, 03-0014878, 03-0014875, 03-0014876, 03-0014877;
d) 03-0182053, 03-0182054, 03-0181621, 03-0179207, 03-0179208, 03-0181600, 03-0181599, 03-0168303, 03-0168304, 03-0155375, 03-0173846, 03-0173847, 03-0181622;
e) 03-0042582, 03-0042580, 03-0042581, 03-0178797, 03-0178798, 03-0178799, 03-0147963, 03-0147964, 03-0147965, 03-0147966;
f) 03-0155377, 03-0173845, 03-0182055, 03-0181623, 03-0155376, 03-0181598, 03-0181624, 03-0179209, 03-0181597, 03-0179210;

a) 03-0182237, 03-0182238, 03-0168105;
b) 03-0168845, 03-0173684, 03-168846, 03-0174935, 03-0174936, 03-0173683
c) 03-0147971;
d) 03-0182232, 03-0182233, 03-0155373, 03-0155374, 03-0179281, 03-0111812, 03-0174933, 03-0161141, 03-0173844, 03-0181625, 03-0173843
RECALLING FIRM/MANUFACTURER
DCI Donor Services Tissue Services Division, Nashville, TN, by letters on May 23, 2005. Firm initiated recall is ongoing.
REASON
Human tissue, which was either implicated in a post-transplant bacterial infection, or was processed in the same manner as tissue that was implicated in a post-transplant bacterial infection, was distributed.
VOLUME OF PRODUCT IN COMMERCE
170 tissue allografts
DISTRIBUTION
New Mexico, TN, CA, NV, and AK.

______________________________
PRODUCT
Human Cadaveric Unprocessed Tissue, Recall # B-0420-7
CODE
A0501, A0502, A0503, A0504, A0505, A0506, A0507, B0501, B0502, B0503,
B0504, B0505, C0501, C0502, C0503, C0507, C0508, D0402, D0502, D0503,
D0504, D0505, D0509, E0401, E0402, E0403, E0404, E0405, E0406, E0407,
E0410, E0411, E0412, E0413, E0502, E0503, E0504, E0506, E0507, E0508,
E0509, E0510, E0511, F0401, F0402, F0405, F0407, F0408, F0410, F0411,
F0502, F0503, G0402, G0403, G0404, G0405, G0406, G0407, G0409, G0502,
G0503, H0401, I0401, I0402, I0403, J0401, J0402, J0403, J0404, J0405, J0406,
J0407, J0408, J0409, J0501, J0503, K0401, K0402, K0403, K0404, K0405,
K0501, K0502, K0503, K0504, K0505, L0401, L0403, L0404, L0405, L0406,
L0407, L0408, L0409, L0410, L0411, L0412, L0501
RECALLING FIRM/MANUFACTURER
Recalling Firm: Donor Referral Services, Raleigh, NC, by facsimile transmission dated June 30, 2006.
Alternate address: Hope of North Carolina, Raleigh, NC. Firm initiated recall is ongoing.
REASON
Human Tissues, recovered from donors without adequate donor eligibility determinations, were distributed.
VOLUME OF PRODUCT IN COMMERCE
99 units
DISTRIBUTION
FL and TX

______________________________
PRODUCT
Human Tissue for Transplantation, Recall # B-0421-7:
a) Achilles Tendon (various sizes), Fresh Frozen, Irradiated;
b) Cancellous Chips, Crushed 1-4mm/15 & 30cc, Freeze Dried, Irradiated;
c) Cancellous Chips 4-10mm/15cc, 30cc & 60cc, Freeze Dried, Irradiated;
d) Cancellous, Cortical Chips 1-4mm/30cc, Freeze Dried, Irradiated;
e) Cancellous Cubes 5-5mm/30cc, Freeze Dried, Irradiated;
f) Cloward Dowel (various sizes), Freeze Dried, Irradiated;
g) Cortical Plate 2x20cm, Freeze Dried, Irradiated;
h) Cortical Button 12x9mm, Freeze Dried, Irradiated;
i) Fascia Lata (various sizes), Freeze Dried, Irradiated;
j) Femoral Head w/Neck (various sizes), Fresh Frozen, Irradiated;
k) Femoral Ring 30mm, Fresh Frozen, Irradiated;
l) Femur Segment 6.0cm, Fresh Frozen, Irradiated;
m) Femur Shaft, Split 23cm, Fresh Frozen, Irradiated;
n) Fibula Ring 0.7cm, Freeze Dried, Irradiated;
o) Fibula Segment (various sizes), Freeze Dried, Irradiated;
p) Gracilis 0.7x28cm, Fresh Frozen, Irradiated;
q) Ilium Tricortical Block (various sizes), Freeze Dried, Irradiated;
r) Patella Tendon, Bisected (various sizes), Fresh Frozen, Irradiated;
s) Patella Tricortical 8x26mm, Freeze Dried, Irradiated;
t) Semitendonosus (various sizes), Fresh Frozen, Irradiated;
u) Tibialis Tendon Anterior (various sizes), Fresh Frozen, Irradiated;
v) Tibialis Tendon Posterior (various sizes), Fresh Frozen, Irradiated;
w) Tibial Shaft, Split (various sizes)
CODE
a) 05-0131-071, 05-0131-072, 05-0138-008, 06-0007-009, 06-0007-010,
06-0019-003;
b) 05-0129-001, 05-0129-002, 05-0129-004, 05-0129-005, 05-0129-007,
05-0129-008, 05-0131-040, 05-0131-041, 05-0131-042, 05-0131-043,
05-0131-044, 05-0131-045, 05-0131-046, 05-0131-047, 05-0131-048,
05-0131-049, 05-0138-023, 05-0138-024, 05-0138-025, 05-0138-026,
05-0139-014, 05-0139-016, 05-0139-017, 05-0139-018, 06-0007-015,
06-0007-016, 06-0007-017, 06-0007-018, 06-0019-017, 06-0019-018,
06-0019-020;
c) 05-0129-009, 05-0129-010, 05-0129-011, 05-0129-012, 05-0129-013,
05-0129-014, 05-129-015, 05-0129-016, 05-0129-017, 05-0131-019,
05-0131-020, 05-0131-021, 05-0131-022, 05-0131-023, 05-0131-024,
05-0131-025, 05-0131-026, 05-0131-027, 05-0131-028, 05-0131-029,
05-0131-030, 05-0131-031, 05-0138-027, 05-0138-029, 05-0138-030,
05-0138-032, 05-0139-019, 05-0139-020, 05-0139-021, 05-0139-022,
05-0139-023, 06-0007-019, 06-0007-020, 06-0007-021, 06-0007-022,
06-0007-023, 06-0007-024, 06-0019-022, 06-0019-023, 06-0019-024,
06-0019-025, 06-0019-026, 06-0019-027;
d) 05-0139-059, 05-0139-060, 05-0139-061, 05-0139-062, 05-0139-063,
05-0139-064, 05-0139-065, 05-0139-066, 05-0139-067, 05-0139-068;
e) 05-0131-014, 05-0131-015, 05-0131-016, 05-0131-017, 05-0131-018,
06-0007-025;
f) 05-0131-050, 05-0131-051, 05-0131-052, 05-0131-053, 05-0131-055,
05-0131-056, 05-0131-057, 06-0007-030;
g) 05-0138-011, 05-0138-012, 05-0138-013, 05-0139-001, 05-0139-002,
06-0007-035, 06-0007-037, 06-0019-016;
h) 05-0139-008;
i) 06-0007-013, 06-0007-014;
j) 05-0138-022, 05-0139-030, 05-0139-031, 06-0007-032, 06-0007-033;
k) 06-0019-009, 06-0019-010, 06-0019-011, 06-0019-012, 06-0019-013,
06-0019-014, 6-0019-015;
l) 05-0131-066, 05-0131-067, 05-0131-069, 05-0131-070;
m) 05-0129-025;
n) 05-0131-037, 06-0007-027, 06-0007-028;
o) 05-0131-036, 05-0138-018, 05-0138-020, 05-0138-021;
p) 06-0007-008;
q) 05-0131-032, 05-0131-033, 05-0131-034, 05-0131-075;
r) 05-0129-032, 05-0129-033, 05-0129-034, 05-0131-073, 05-0131-074,
06-0007-011, 06-0007-012;
s) 06-0007-031;
t) 05-0138-003, 06-0007-006;
u) 06-0007-001, 06-0007-002;
v) 06-0007-003, 06-0007-004;
w) 05-0139-003, 05-0139-005, 05-0139-006
RECALLING FIRM/MANUFACTURER
Alamo Tissue Services, Ltd., San Antonio, TX, by letters on June 28, 2006. Firm initiated recall is ongoing.
REASON
Human Tissues, recovered from donors without adequate donor eligibility determinations, were distributed.
VOLUME OF PRODUCT IN COMMERCE
161 units
DISTRIBUTION
Nationwide




RECALLS AND FIELD CORRECTIONS: VETERINARY MEDICINE -- CLASS II

______________________________
PRODUCT
Feed 454A - Kalmbach 18% Turkey & Broiler Grower/Finisher Pellet (Medicated), Net Weight 50 LBS., Recall # V-009-2007
CODE
Lot: 004863
RECALLING FIRM/MANUFACTURER
Kalmbach Feeds Inc, Upper Sandusky OH, by telephone on November 29, 2006. Firm initiated recall is ongoing.
REASON
Off label use of Type A medicated article. Product is labeled for calves and used in poultry feed.
VOLUME OF PRODUCT IN COMMERCE
50/50 lb. bags
DISTRIBUTION
PA and MI

END OF ENFORCEMENT REPORT FOR DECEMBER 27, 2006

###



http://www.fda.gov/bbs/topics/enforce/2006/ENF00984.html


http://lists.ifas.ufl.edu/cgi-bin/wa.exe?A2=ind0612&L=sanet-mg&T=0&P=12771

http://www.microbes.info/forums/index.php?showtopic=375

http://lists.iatp.org/listarchive/archive.cfm?id=119823

http://lists.ifas.ufl.edu/cgi-bin/wa.exe?A2=ind0612&L=sanet-mg&T=0&P=11421

http://lists.ifas.ufl.edu/cgi-bin/wa.exe?A2=ind0612&L=sanet-mg&T=0&P=5165

http://list.uvm.edu/cgi-bin/wa?A2=ind0610b&L=safety&D=1&P=2658

http://vcjdblood.blogspot.com/



TSS
 
Top